1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arte-miy333 [17]
3 years ago
10

Which organelles are labeled D?

Biology
2 answers:
anastassius [24]3 years ago
7 0
Assuming that the D label refer to the two blocks right outside the nucleus, 

They are called centrioles.

In animal cell, the centrioles are responsible in the process of Cell division

hope this helps
LUCKY_DIMON [66]3 years ago
6 0
<h3><u>Answer;</u></h3>

<em>Centrioles </em>

<h3><u>Explanation;</u></h3>
  • <em><u>Centrioles</u></em> are organelles that are only found in animal cells.
  • <u><em>Centrioles are important organelles that functions by helping the process of cell division in animal cells.</em></u> This is by helping the formation of spindle fibers whose role is to separate chromosomes during cell division.
  • Additionally, <em><u>centrioles also play a very important role in celiogenesis, the formation of cilia and flagella on the surface of cells.</u></em> The cilia and flagella enhance the movement of cells.
You might be interested in
Can anyone answer these correctly please? :)
kherson [118]
  1. D
  2. A
  3. A,C,and F
<h2>Hope this helps!</h2>
4 0
3 years ago
Which of the following is NOT part of the Cell Theory?
castortr0y [4]

Answer:

3 it is 3 3333333333333

4 0
2 years ago
What is mostly ice and orbital period is 3.3 to 70,000 years
vladimir2022 [97]
U mean y not what deaar!!
6 0
3 years ago
A phylum is always associated with:
harina [27]

Answer:

plants

Okkk kkkkkkkkkkkk

4 0
3 years ago
Read 2 more answers
A student completed a lab report. Which correctly describes the difference between the “Question” and “Hypothesis” sections of h
Alisiya [41]
A question is something someone asks.  A hypothesis is like a person's theory.
7 0
3 years ago
Read 2 more answers
Other questions:
  • if shoe it to foot , as glove is to hand...complete the following: Simple sugar (monosaccharide) is to carbohydrate as amino aci
    7·1 answer
  • A baby blue whale drinks this many liters of milk per day:
    11·1 answer
  • The new tools of genetic engineering allow us to manipulate __________ directly.
    5·2 answers
  • Which process provides environments that are conducive for marine ecosystems?
    15·2 answers
  • Explain why overpopulation occurs and how it impacts ecosystems.
    10·1 answer
  • CAN SOMEONE PLEASE HELP ME WITH ONE OF MY BIOLOGY QUESTIONS, PLEASE?
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following affects the speed of a planet's revolution?
    9·2 answers
  • Explain the concept of functional specialisation and describe two brain areas that exhibit functional specificity
    14·1 answer
  • How society controls science
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!