1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
13

How do invasive species disrupt non-native ecosystems?

Biology
1 answer:
Sloan [31]3 years ago
8 0
There are many ways they can disrupt their new environments.

They can often carry diseases or parasites that native species are unequipped for. A good example of this is cats being brought to Australia, a continent with no native felidae. Cats are one of the main carriers of toxoplasmosis and many species in Australia had not evolved alongside felidae and were relatively unequipped to handle these parasites if their immune system was vulnerable.


They can also cause issue simply because they are so different, and the animals and plants living I. These areas are simply unable to defend themselves or keep up as a result. Such as pigs (and other animals brought over by humans) eating dodo bird eggs (these birds roosted on the ground) and domestic cats overhunting for sport.

Hope this helps a bit! It's a pretty broad topic and definitely one worth researching even more
You might be interested in
All of the following events occur during normal meiosis except _______. A. two haploid gametes fuse to form a diploid cell B. on
lesya692 [45]

Answer:

A. two haploid gametes fuse to form a diploid cell

Explanation:

Meiosis is a type of cell division. When a parent cell with "2n" chromosomes enters the process of meiosis, four daughter cells each with "n" chromosomes are formed. This occurs since homologous chromosomes separate from each other during anaphase-I. However, meiosis does not include the fusion of two haploid cells. The fusion of two haploid cells mainly occurs during the process of fertilization during which a haploid male gamete and a haploid female gamete fuse to form a diploid zygote.

7 0
3 years ago
Succession occurs when environmental factors affecting an ecosystem change. True or False
zhannawk [14.2K]

Answer: True

Succession is the phenomena in which changes in the biotic and abiotic factors of the environment leads to change in the ecosystem. A succession is a process in which a biological community is replaced by another biological community until a mature ecosystem is formed this process is influence by environmental factors. Primary succession is the primitive environment where no biotic community previously existed it is followed by secondary and subsequent succession were life forms develop and form an ecosystem. Some of the environmental factors are:

Topographical : These are the change in the region or habitat were succession occurs. Landslides, volcanic eruption, glacier melting etc. are the examples , as these topographical changes can bring reformation of the landscape. The disturbance caused by these topographical changes will allow the disturbance tolerant species to repopulate the habitat.  This can be a transition from primary to secondary succession.

Soil : It is an abiotic factor.The growth of the plants requires suitable soil conditions. The type of soil will affect which species will inhabit the area. The soil moisture and pH greatly affect the number of plant species in an area.

Climate : It can influence the direction of succession. Climatic factors includes rain, wind etc. For example a region lacking proper rainfall the species will be tolerant to dry and drought conditions. The region with heavy rainfall, the species will be more tolerant to moisture. Wind being a climatic factor can cause wind erosion affect the soil quality. Wind can lead to heavy forest fires can therefore, wiped out community.

8 0
3 years ago
Read 2 more answers
Which process listed does not require oxygen be present? A. anaerobic respiration B. aerobic respiration C. ethyl alcohol fermen
erma4kov [3.2K]
C. Ethyl alcohol fermentation is your answer.
8 0
3 years ago
Match the tissues to their functions.
omeli [17]

Answer:

Nervous Tissue -- signal conduction

Epithelial Tissue -- protection of organ

Muscle Tissue -- contraction and relaxation

Connective Tissue - structural support

4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • ATP is thermodynamically suited as a carrier of phosphoryl groups in animal cells because of all EXCEPT ________.
    14·1 answer
  • Which term correctly identifies this part of a dermal (skin) cell?
    14·2 answers
  • Which of the following does not involve any friction
    12·1 answer
  • A researcher made an interesting observation about a protein made by the rough endoplasmic reticulum and eventually used to buil
    7·1 answer
  • What does the human digestive system do?
    10·2 answers
  • Cell growth and cell division are processes that are regulated by specific genes. Mutations in these
    13·2 answers
  • Give an example of physical weathering.
    12·1 answer
  • Organisms that use energy to control their internal conditions are
    10·1 answer
  • How might genetic variation arise?
    8·1 answer
  • Runoff that contains fertilizers can cause increased levels of nitrogen in the ocean. What is a possible result of these increas
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!