1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
6

Which important phenomena occur in plant leaves and help water transportation in xylem tissues

Biology
2 answers:
Lelechka [254]3 years ago
4 0
Transpiration in which stomata opens and closes I think so
lutik1710 [3]3 years ago
3 0
Evaporation of water creates a negative vaccum in the leaves causing water to be drawn up the xylem

hope that helps
You might be interested in
Explain what happens during reverse transcription.
PIT_PIT [208]

Answer:

First of all, the reverse transcriptase synthesizes viral DNA from viral RNA, and then from newly made complementary DNA strand. The second replication process occurs when host cellular DNA polymerase replicates the integrated viral DNA. ... Therefore, mutation can occur during one or all of these replication steps.

Explanation:

7 0
3 years ago
Read 2 more answers
Compare hookworms and ascaris worms, include both similarities and differences
Monica [59]

Scientists study both the flatworm Planaria and the roundworm Caenorhabditis elegans in laboratories, using them as test subjects, and while they may seem similar, they have some distinct internal and external differences. Flatworms (phylum Platyhelminthes) and roundworms (phylum Nematoda) differ in shape, means of locomotion, how their digestive systems function, and in the ways they are harmful to human beings. While both species are called worms, they are not closely related.


5 0
3 years ago
How are fossil fuels used in the harvesting of fresh apples from an apple tree?
lys-0071 [83]

The correct answer is option B

The use of fossil fuel in harvesting of apples lies at the stage when the apples fall from the tree. When there lots of apple that has to fall from the tree and picked up for sorting. Monster machines are used for the shaking of trees vigorously so that lots of apple fall at a same time. This machine use fossil fuel for its working.

5 0
4 years ago
Read 2 more answers
What does the destruction of the amazon forest threaten the whole world
Iteru [2.4K]

Answer:

c

Explanation:

Deforestation is a particular concern in tropical rain forests because these forests are home to much of the world's biodiversity. For example, in the Amazon around 17% of the forest has been lost in the last 50 years, mostly due to forest conversion for cattle ranching.

4 0
3 years ago
Urgent Care Centers are extremely busy during cold and flu season. The influenza virus can causes symptoms such as a cough, high
Andrei [34K]

Answer:

-Avoid large crowds

-Wash your hands regularly

-Strengthen your immune system

-Get an annual flu vaccine

-Clean and disinfect surfaces

5 0
3 years ago
Other questions:
  • What are the three components of DNA? Where are they located on the “twisted ladder?”
    10·1 answer
  • Which genetic disorder causes the body to produce unusually thick mucus in the lungs and intestines? a. hemophilia b. Down syndr
    6·2 answers
  • What is the difference between the key words "trait" & "allele" ?
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Whats a hitchhiking arachnid?
    15·1 answer
  • NEED HELP ASAP RN PLS!!!!! THIS IS EASY!!
    7·1 answer
  • A bacterial cell has been genetically modified to have a plasmid that contains a gene that codes for human growth hormone (HGH).
    13·1 answer
  • What variations can individuals exhibit?​
    9·1 answer
  • Easy one - giving brainly - show work.​
    13·1 answer
  • How does the codon help determine the function of the protein it is coding for?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!