1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mekhanik [1.2K]
4 years ago
13

Which of these molecules is not a product of the Electron Transport System?

Biology
1 answer:
bixtya [17]4 years ago
7 0
The answer would be B) oxygen. In the electron transport chain, oxygen is a reactant. It reacts with 4 electrons and 4 hydrogens to form 2 water molecules. NAD plus is a product of NADH losing an electron. FAD is a product of FADH2 losing an electron.
You might be interested in
Which of the following is the major source of energy responsible for the
Alisiya [41]
The correct answer is D.) The sun

The sun’s heat causes liquids to evaporate into water vapor, which rises and forms clouds. The whole water cycle repeats itself again because of the sun.
6 0
3 years ago
A cell with 22 chromosomes undergoes meiosis. How many nuclei result from this process? Need ASAP
qaws [65]

Answer:

The overall process of meiosis produces four daughter cells from one single parent cell

Explanation:

Germ cells contain a complete set of 46 chromosomes (23 maternal chromosomes and 23 paternal chromosomes). By the end of meiosis, the resulting reproductive cells, or gametes, each have 23 genetically unique chromosomes.

8 0
2 years ago
Explain how xylem cells are adapted for their function.<br>​
s2008m [1.1K]

Answer:

Xylem cells have no cytoplasm or end walls, meaning they form a tube through which water can pass freely to allow water transport. Lignin strengthens the cell walls, helping to support the plant.

8 0
3 years ago
Read 2 more answers
All of the following are examples of physical properties EXCEPT
Hitman42 [59]
Density hope this helps!
5 0
3 years ago
Read 2 more answers
What is the green pigment found in plants
olga_2 [115]
Dryed up burt that can be use to make the plantes grow even with water
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which type of electron microscope is used to view the surface of specimen in great detail?
    12·1 answer
  • Why are groups of small cells better than one large cell at moving material in<br> and out?
    8·1 answer
  • What sort of insect has six legs? List one fact about it as well
    12·2 answers
  • Which pair of properties apply to both mechanical and electromagnetic waves?
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Question 3<br> Tissues working together to perform specialized functions are called -
    9·1 answer
  • 5. All cells
    14·1 answer
  • Bonus: How many Earths wide is the sun? How many Earths could fit
    14·1 answer
  • Can somebody help me?
    7·1 answer
  • How is the energy produced by respiration stored? (Googled answers will be reported) (actual answers please)
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!