1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ki77a [65]
3 years ago
5

PLEASE HURRY!!!

Biology
1 answer:
Setler79 [48]3 years ago
5 0
Number 8 is translation
You might be interested in
What is the name of the topic that we are covering?
Thepotemich [5.8K]
Gonna need a bit more information then that if you want an answer.
8 0
3 years ago
Oxygen is required to conduct cellular respiration. <br> true/false?
olga2289 [7]
THE ANSWER WOULD BE TRUE
3 0
3 years ago
Read 2 more answers
Communication between neurons occurs from contact between the two neurons. when the intensity of the action potential increases
Kitty [74]

Answer:

The correct answer is - when action potentials trigger the release of neurotransmitters.

Explanation:

Communication between neurons takes place by signaling that can be either chemical signaling or electrical signals. Communication between neurons occurs at very small gaps known as synapses.

These synapses have two specialized cells that help two neurons communicate by one to another to allow for chemical transmission. The chemical that isreleased due to the stimulation of the action potential in order to communicate the neurons are known as neurotransmitters that allow for transmission.

8 0
3 years ago
Number of techniques for overcoming nervousness and releasing nervous energy before giving an oral presentation. One is to remin
UNO [17]

Answer: taking deep breaths

Explanation:

Apart from reminding oneself that you are prepared for the presentation. You can carry out a physical exercise like the breathing exercise by taking several deep breaths and exhaling to reduce nervousness. Also you should be mindful that the audience is there to hear you and not to judge you. In that way you can ease out tension.

8 0
3 years ago
Fibers linking the __________ to the __________ grow and myelinate from birth through the preschool years, contributing to drama
jarptica [38.1K]
Your answer is c<span>erebellum; cerebral cortex.</span>
4 0
3 years ago
Other questions:
  • Information gathered from observing a plant grow 3 cm over a two-week period
    14·1 answer
  • Which genotype will offspring have if they inherit the a allele from both parents
    8·2 answers
  • Why is rice grown in clayey soil not in black soil​
    9·2 answers
  • Which gland helps the body prepare for and handle stress?
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which statement best describes geothermal energy?
    14·1 answer
  • Prader-Willi syndrome is a genetic disorder involving a partial deletion of chromosome 15q on the paternal chromosome. When both
    9·1 answer
  • the human nervous system is broken up into central and peripheral parts. the central system (cns) is made up of
    13·1 answer
  • Which derived character caused the k. monera to be divided into the k. archaebacteria and the k. eubacteria?
    9·1 answer
  • How are acids and protons related? (1 point)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!