1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
4 years ago
5

Identify two general ways chemical mutagens can alter dna.

Biology
1 answer:
gavmur [86]4 years ago
6 0
1) compound mutagens can go about as base analogs 
Analogs are perceived by DNA polymerase and consolidated into DNA set up of nucleotides and after that reason change by base-matching in a way that varies from the undifferentiated from nucleotide. For instance, 5-BrdU can be consolidated inverse An amid replication and after that combine as a C amid the following round of replication, making a TA CG change. 
2) substance mutagens can synthetically adjust base. 
Compound adjustment of bases changes their base-blending properties to such an extent that an altered purine will base-match with the wrong pyrimidine and the other way around. For instance, EMS is an alkylating operator that proselytes guanine to O6-methylguanine, which base-sets with T to make a GC to AT progress
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Repressors are transcription factors that bind to _____________sequences in dna
Trava [24]

Answer:

The given blank can be filled with operator.

Explanation:

The proteins that assist in turning on or turning off the function of a specific gene by getting combined with certain sections of the DNA are known as transcription factors. The transcription factors that activate the transcription of a specific gene are known as activators, while that prevents transcription and is termed as repressors.  

A repressor can be an RNA or a DNA binding protein, which prevents the articulation of genes by getting combined with the operator. A repressor, which binds with DNA prevents RNA polymerase from getting combined with the promoter, which further inhibits the transcription of the genes into mRNA.  

6 0
3 years ago
What is found in the nucleus of an atom? Question 1 options: electrons neutrons and protons protons and electrons neutrons and e
ladessa [460]

Answer: in the atom you can find: electrons and protons

Explanation:

You can find electrons in an atom because it is the negative energy that rounds the atom on the outside’s part.

Then, the protons are the positive energy that is on the atom’s inside.

Both of the energies are fused and it end on a neutron energy.

4 0
3 years ago
Read 2 more answers
Is a group of species that includes an ancestral species and all of its descendants?
Alekssandra [29.7K]
A clade is a group of species that includes an ancestral species and all of its descendents
5 0
3 years ago
What are the important events and end products of light reaction
german

Answer:

The important events of light reaction are (i) Excitation of chlorophyll molecule to emit a pair of electrons and use of their energy in the formation of ATP from ADP + Pi. This process is called photophosphorylation. Splitting of water molecule (a) (b) End products of light reaction are NADPH and ATP.

3 0
3 years ago
Read 2 more answers
Other questions:
  • If an object turns but maintains the same speed,has its acceleration changed?explain
    8·1 answer
  • if a cell is isotonic in an 80% sucrose solution, how will the movement of water across the cell membrane affect the size of a c
    8·2 answers
  • Select all the apply proteins__.
    14·1 answer
  • Which of the following is/are true?
    7·1 answer
  • Which is a characteristic of soil with a high percentage of clay?
    13·1 answer
  • A solution that causes a cell to swell because of osmosis.
    15·2 answers
  • Coin tosses can demonstrate the effects of genetic drift. Imagine that heads and tails are two alleles in a population. Consider
    9·1 answer
  • Hurry please! According to the cell theory where did this cell come from?
    14·1 answer
  • A student encounters a pondweed which, judging from its appearance, seems to be a charophyte. She brings a sample back to her bi
    14·1 answer
  • 2.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!