Answer:
CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA
Explanation:
Cytosine pairs with Guanine.
Adenine pairs with Thymine.
Since, the experiment is not given but on the basis of the mechanism of genetic transfer this question can be answered.
Answer:
The mechanism of gene transfer is important and beneficial for bacteria in the adverse environment conditions. The different mechanism of gene transfer are conjugation, transformation and transduction.
The ampicillin resistance gene is present on the plasmid DNA and not on the chromosomal DNA. Only conjugation is the mechanism in which the plasmid DNA is transferred from one bacteria to another bacteria. The ampicillin resistance gene is transferred from Strain II to strain I means from the bacteria that has the ampicillin resistance gene to the bacteria that has no ampicillin resistance gene in it.
The acids have more H+ while bases have more OH-. About pH, typically under room temperature, when a solution has pH<7, it is acid. When pH>7, it is base. And when pH=7, it is neutral.
A sensory nerve is really a collection of long dendrites carrying messages to the central nervous system from the periphery.
Answer:
▪ Please Define Balance diet
<h2>
➢ <u>Healthy diet</u></h2>
<em>A healthy diet is a diet that maintains or improves overall health. A healthy diet provides the body with essential nutrition: fluid, macronutrients such as protein, micronutrients such as vitamins, and adequate fibre and food energy.</em>
<h2><em>➢</em><u>Importance</u></h2>
<em>A healthy diet is <u>essential for good health and nutrition</u>. It protects you against many chronic noncommunicable diseases, such as heart disease, diabetes and cancer. Eating a variety of foods and consuming less salt, sugars and saturated and industrially-produced trans-fats, are essential for healthy diet.</em>
<h2><em>➢</em><u>Components</u></h2>
<em>The 7 components of a balanced diet are <u>Carbohydrates, Proteins, Fats, Vitamins, Minerals, Fibre and Water.</u></em>
<em><u>
</u></em>
#CarryOnLearning
