1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
14

Is a compound is a pure substance? * I"m just wondering,

Biology
2 answers:
zheka24 [161]3 years ago
6 0

Answer:

Yes, it is.

Explanation:

Because there's no physical change that can separate compounds into more than one kind of substance.

bija089 [108]3 years ago
3 0

Answer:

yes

Explanation:

Compounds: are pure substances that are made up of more than l type of atom and can be broken down or decomposed into its individual elements by chemical methods, but cannot be separated by physical methods. The ratio of the elements in a compound are always constant. (Water is always 11 % Hydrogen and 89 % oxygen).

You might be interested in
Why are frozen pipes a problem in very cold countries?? ​
Arada [10]
When it gets cold, the accumulated water inside the pipes freezes, expands and creates extreme pressure.
5 0
3 years ago
What element is in group 18 periodic 3
marishachu [46]

Answer:

ARGON

hope this helps

the element that is in the group 18 periodic 3 is argon

4 0
3 years ago
Read 2 more answers
Ed was in a bicycle accident, he had no sensations in his injured leg. He can move the limb normally. Based on the functional cl
____ [38]
There are two types of neurons in our legs: motor neuron and sensory neuron. These send and receive messages to and from each other and the brain.  

After Ed's accident, he can't move his injured leg since the motor neuron is dysfunctional. The sensory neuron is functional so he can feel his limbs but can't move them since when the sensory neuron sends a message to the motor neuron, it isn't able to deliver the message to the brain to make the leg move. This is why he can still feel his limbs but is not able to move them.  
7 0
3 years ago
Which temperature scale measures water boiling at 373 degrees?
kipiarov [429]
Sense the temperature is increasing, it’ll be A. Fahrenheit bro
8 0
3 years ago
Read 2 more answers
Which statement about vacuoles is true?
VARVARA [1.3K]

Vacuoles are storage organelles that are found in both animal and plant cells. They store food or any other forms of nutrients, they also store waste products so as to protect the contamination of the cell environment. These waste products are sent out of the cell via vacuoles. In plants the vacuoles are larger than in animals. The vacuole provides plant nourishment in the scarcity of water in the external environment hence, prevents the wilting of plants.

7 0
3 years ago
Other questions:
  • The skeletal system gives the body a rigid framework, thanks to the ____________ tissue it is made of.
    13·1 answer
  • Would a female become pregnant is sperm is on the labia?(my biology teacher asked this...)
    13·1 answer
  • Which is least likely to be impacted by runoff from a factory?
    12·1 answer
  • Which technique is most accurate in identifying an appropriate vein site for iv catheter insertion into the arm?
    7·2 answers
  • What substance makes up 75 to 90% of every cell in the human body?
    13·2 answers
  • A well designed experiment _____.
    5·2 answers
  • Which of the following is NOT a rule when writing a hypothesis?
    10·1 answer
  • PLEASE HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    8·1 answer
  • What techniques do you think Shubin and his fellow researchers used to determine how deep they should dig to look for Tiktaalik?
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!