1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Strike441 [17]
3 years ago
5

What is this 5,0000x345,00000?

Biology
1 answer:
Marat540 [252]3 years ago
7 0
5,0000 * 345,00000 =1.725
You might be interested in
What are some differences between the "Steady State" and "Big Bang" theories?
Alex17521 [72]

Answer:

The major difference between the Big Bang theory and the steady state model is that the the big bang theory comes with the belief and idea that all the matter were created as a result of one big bang explosive beginning.

The steady state model matter however talks about matter being created at a steady rate through a specified time. The model also talks about the process being continual and is still happening till today.

7 0
3 years ago
What arctic animals will climate change affect
bazaltina [42]

Answer:

polar bears

Explanation:

4 0
3 years ago
Read 2 more answers
Which choice is considered an integral membrane protein?
Solnce55 [7]

Answer:

A protein with its amino-terminus in the cytoplasm and its carboxy-terminus in the extracellular space. (Ans. A)

Explanation:

Integral membrane protein (IMP) is defined as a membrane protein molecule which is directly attached to the biological membrane known as phospholipid bilayers. All transmembrane proteins are integral membrane protein but not all integral membrane protein are transmembrane proteins.

Integral membrane proteins function as a transporter, receptors, channels, proteins which is responsible for cell adhesion, proteins are also Involved in transduction and build up of energy.

Membrane proteins are class according to their transmembrane domain properties. The N-terminus of an integral membrane protein type I is in the endoplasmic reticulum lumen, where N-terminus of an integral membrane protein type II in the cytoplasm.

4 0
3 years ago
A person with an injury to her frontal lobe may have
gtnhenbr [62]
Increase in irritability , ie change in mood and an inability to regulate behaviour
8 0
3 years ago
NEED ANSWER QUICK. 80 PTS
Anestetic [448]
B.
Passive transport doesn't requireenergy (ATP), active transport doesrequire energy. Passive transport moves molecules WITH the concentration gradient (high to low), while active transport moves molecules AGAINST the concentration gradient (Low to High).
6 0
3 years ago
Read 2 more answers
Other questions:
  • The registered nurse anesthetist has administered a small dose of nondepolarizing neuromuscular junction (nmj) blocker before ad
    6·1 answer
  • Which of the following is not recognized domain of the classification of living thing
    14·1 answer
  • Planets formed from a nebular cloud of
    7·1 answer
  • What three parts does a nucleotide consist of?
    11·2 answers
  • Which of the following is the type of bond develops between molecules of water in a beaker of water
    14·2 answers
  • How does chlorine form an ion
    6·1 answer
  • Throughout history, amoebic dysentery has resulted in the deaths of many soldiers. Deaths from this illness have often exceeded
    8·1 answer
  • What bacteria live in the root nodules of legumes?
    13·1 answer
  • Which planet is associated with the Great Dark Spot?<br> luniter
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!