1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alisha [4.7K]
3 years ago
9

Based on the graph, which inequality is correct for a number that is to the left of -4?

Biology
1 answer:
babunello [35]3 years ago
3 0

Answer:

I think it is 4 > −3

Explanation:

Because thats what i got for my answer

<h2><em>Plz mark me brainliest</em></h2>
You might be interested in
The most serious consequence of acute pancreatitis resulting from biliary obstruction is
Shalnov [3]
<span>The most serious consequence of acute pancreatitis resulting from biliary obstruction is the development of circulatory shock.</span>
<span>In rare cases, acute pancreatitis can lead to necrosis of pancreas tissues. Pancreatic enzymes may get into the bloodstream and cause inflammation and damage to other organs which then can lead to shock, respiratory failure, kidney failure and other complications. This is a very serious situation which can be fatal.</span>
6 0
3 years ago
Classify each statement based on whether it describes prokaryotes only, eukaryotes only, or can describe both prokaryotes and eu
Phantasy [73]

Answer:

unicellular - both prokaryotes and eukaryotes

contain mitochondrion - eukaryotes only

are generally less than 2 pm - Prokaryotes only

multicellular - eukaryotes only

lack membrane-bound organelles - prokaryotes only

Explanation:

Prokaryotes are generally unicellular, that is, they are made up of single cells only. However, there are unicellular and multicellular eukaryotes with some eukaryotes like humans and advanced plants having as many as millions of cells.

Prokaryotes generally lack nucleus and other membrane-bound organelles such as chloroplast and mitochondrion. Eukaryotes on the other hand have nucleus and membrane-bound organelles such as mitochondrion and chloroplast.

When it comes to size, prokaryotes are generally small and microscopic while eukaryotes consist of both microscopic and macroscopic cells or organisms. However, prokaryotes are generally smaller than microscopic eukaryotes.

7 0
3 years ago
What is the correct definition of the term systemic circulation?
seropon [69]
The correct answer is ( B )
4 0
3 years ago
Easy Question. Will Mark Brainliest.
dexar [7]

Answer:

This is an example of biotechnology because it seeks to solve a societal problem using biological entities.

8 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Which best describes accuracy
    13·2 answers
  • Which organism did Gregor Mendel use to discover the basic principles of genetics?
    7·1 answer
  • Which statement best describes the movement of carbon dioxide into or out
    7·1 answer
  • A gas can be squeezed into a smaller container, but a liquid cannot. What does this suggest about the arrangement of particles i
    5·1 answer
  • Which of these is a function of the circulatory system?
    9·1 answer
  • A newly pregnant woman is trying to choose a health care provider for her pregnancy and birth. she desires to have the health ca
    11·1 answer
  • 4. What boundaries destroy oceanic crust?​
    12·1 answer
  • The table lists four major groups of plants and shows whether each group has three important traits.
    10·2 answers
  • A virus uses the _________ and another part puncture the cell.
    11·1 answer
  • Help please<br> Human traits determined by dominant and recessive alleles
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!