1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dimulka [17.4K]
3 years ago
5

Which describes one characteristic of both El Niño and La Niña?

Biology
2 answers:
nignag [31]3 years ago
7 0

Answer:

Both occur in the Pacific Ocean.

Explanation:

El Niño and La Niña are opposite phases of a natural climate pattern across the tropical Pacific Ocean that swings back and forth every 3-7 years on average

Zigmanuir [339]3 years ago
4 0

Answer:

The correct answer is : C

Explanation:

I did the test on edge :>

You might be interested in
List one human-infecting virus that has a DNA-based genome.
bazaltina [42]
Bacteriophages, Adenoviruses, or parvoviruses
4 0
3 years ago
Typically, roofs on houses in the tropics are white. What advantage does this provide to the inhabitants?
iren [92.7K]
The last one E is correct
8 0
4 years ago
Why is your body going through physical and chemical changes?
SCORPION-xisa [38]

Answer:

(MY) body is only going through chemical changes because of my digestive juices, my saliva, and brain functions.

Explanation:

{MY} body isn't going through many physical changes other than my body slowly breaking down on a nuclear level every day slowly just like everybody else that's why nobody dies of old age, its just the teardown of their body eventaully giving out

7 0
3 years ago
Why is it important for scientists to share results with others working in their field?
kap26 [50]
When they compare they can see the difference and similarities to get to the end result
5 0
4 years ago
If steel is more dense than lake water, why can a boat float? the average density of the boat, including the steel and air, is l
sergejj [24]
Or <span>The average density of the boat, including the steel and air, is less dense than 1.00 g/cm³..</span>
4 0
4 years ago
Read 2 more answers
Other questions:
  • What is one adaptation that helps people survive
    15·1 answer
  • What are the two main types of freshwater wetlands?
    10·1 answer
  • Which scientist hypothesized that more offspring were born in a population than could survive based on limited resources? Erasmu
    12·2 answers
  • A substance is most likely to diffuse into a cell when
    13·1 answer
  • Which of the following is the correct sequence of events in caellular respiration
    8·1 answer
  • What is the importance of having the US Forest Service, the Bureau of Land Management, the US Fish and Wildlife Service, and the
    11·2 answers
  • Long tubes that carry water and sugar from leaves to the rest of the plant are known as
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • PLEASE HELP! WILL MARK BRANLIEST!<br><br> Fill in the correct answers in the boxes below.
    14·1 answer
  • (Evolution #2 - 10)All of the following adaptations would help a plant survive in the desert EXCEPT.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!