1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EastWind [94]
3 years ago
7

If steel is more dense than lake water, why can a boat float? the average density of the boat, including the steel and air, is l

ess dense than 1.00 g/cm³. the average density of the boat, including the steel and air, is more dense than 1.00 g/cm³. lake water is more dense than pure water. steel has a special ability to float regardless of density.
Biology
2 answers:
Taya2010 [7]3 years ago
7 0
<h3><u>Answer;</u></h3>

The average density of the boat, including the steel and air, is less dense than 1.00 g/cm³.

<h3><u>Explanation</u>;</h3>
  • <em><u>The average density of an object determines whether the object sinks or floats.  Therefore the average density determines whether the boat will sink or float on water.</u></em>
  • Reducing the average density makes a steel boat float on water.  Additionally making steel hollow also makes a boat float as this expands its volume  without changing its mass.  
  • <em><u>Steel is strong, but it is quite easy to reduce the average density of a boat to less than the density of water by making the shell of the boat very thin hence making if float</u></em>.

sergejj [24]3 years ago
4 0
Or <span>The average density of the boat, including the steel and air, is less dense than 1.00 g/cm³..</span>
You might be interested in
Hellooo help please! no random stuff just 50$$!! or coins-
Reika [66]

answer:

i would have to say B or C. leaning more one C though, i hope i'm right haha. best of luck!! :D

6 0
3 years ago
What molecules are broken down the most often to make ATP
Salsk061 [2.6K]
Lipids and carbohydrates
5 0
3 years ago
27. What adaptation do organisms that live in an estuary have?
Kamila [148]
The answer is B, or They can survive in changing salinity.
7 0
1 year ago
Read 2 more answers
Define ecological succession <br>​
enot [183]
Ecological succession is the process of change in the species structure of an ecological community over time. The time scale can be decades, or even millions of years after a mass extinction
7 0
2 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
2 years ago
Other questions:
  • In DNA adenine levels were equal to thymine levels and cytosine levels were equal to guanine levels.
    14·1 answer
  • Radiometric dating is used to tell the absolute age of materials by studying the decay rate of radioactive isotopes. The decay r
    7·2 answers
  • What adaptations would a plant living in a river need that a plant living in a pond would not need?
    10·2 answers
  • How would you describe the appearance of the substance after the phase change?
    9·1 answer
  • If a company developed a way to modify a person’s DNA to guarantee certain attributes in offspring, should that company be force
    7·2 answers
  • How many radians are in 160°
    13·1 answer
  • Plants take up carbon dioxide from the air and nutrients from the soil. This is an example of interactions between the
    12·2 answers
  • ____transport doesn't need an input of energy of the cell. (fill in the blank)
    5·1 answer
  • How are viruses different from bacteria? A) Bacteria are heterotrophic while viruses are autotrophic. B) Bacteria are living org
    15·2 answers
  • A mutation that involves one or just a few nucleotides is known as what? A. point B. minor C. chromosomal​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!