1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
2 years ago
14

State four factors that influence the heart rate.​

Biology
1 answer:
kvasek [131]2 years ago
6 0

Answer:

Emotions and anxiety can raise your heart rate! Unlike an automobile that is purely mechanical, we are not solely governed by working parts. Some days you can “feel” your way to a higher HR.

Body Temperature: If you become too hot or too cold your body senses a thermal stress load. Blood is sent to your skin to enhance heat dissipation to cool you or increases blood flow to warm you. Apparent temperatures (which account for humidity or wind chill) above 70 degress (F) and below 35 degrees (F) will increase your heart rate at least 2-4 beats per minute. Over 90% humidity can equal as much as a 10 beat increase in heart rate.

The terrain. Walk or run uphill and your HR increases. Walk or run downhill and your HR decreases.

Wind. Walking or running with the wind at your back is easy, therefore HR decreases. Walking or running into the wind is more difficult: HR increases.

Dehydration. As you become increasingly dehydrated during a long walk, hike, or run, your blood becomes thicker and waste products build up in bloodstream. Your heart will work harder to maintain constant cardiac output. A fluid loss of 3% of body weight increases pulse rate because of decrease in circulating blood volume.

Diminishing glycogen stores — your muscles primary fuel source. As the fuel depletes, in order to maintain the same walking or running pace, your HR rises.

Insufficient nutrition. HR increases.

Insufficient sleep. HR increases.

Insufficient recovery after a long hike, run, or other hard workout. HR increases.

Recent illness — or — a signal of impending illness. You guessed it!

Medication – depending upon the medication, heart rate can either decrease or increase. Be certain to ask your physician about any medication you are taking and its effects on your exercise heart rate.

Explanation:

I know its alot so I would pick at least 3 for your answer hope it helps

You might be interested in
Each of the four pedigrees that follow represents a human family within which a genetic disease is segregating. Affected individ
Ne4ueva [31]

 Answer:

<u> The following four traits are -: </u>

  • <u>Pedigree 1 -</u> A recessive trait (autosomal recessive)  is expressed by pedigree 1.
  • <u>Pedigree 2- Recessive inheritance is defined by Pedigree 2. </u>
  • <u>Pedigree 3</u> - The inheritance of the dominant trait (autosomal dominant) is illustrated by Pedigree 3.
  • <u>Pedigree 4-</u> An X-like dominant trait is expressed by Pedigree 4.    

Explanation:

<u>Explaination of each pedigree chart</u>-

  • Pedigree 1 demonstrates the <u>recessive trait </u>since their children have been affected by two unaffected individuals. If the characteristics were X-linked, in order to have an affected daughter, I-1 would have to be affected. X^A In this, both parents are autosomal recessive trait carriers, so the child will be affected by a 1/4 (aa)
  • <u> Recessive inheritance</u> is defined by <u>Pedigree 2</u>. This is<u> X-related inheritance as autosomal recessive</u> inheritance has already been accounted for in part 1. This inference is confirmed by evidence showing that the father (I-1) is unaffected and that only the sons exhibit the characteristic in generation II, suggesting that the mother must be the carrier. The individual I-2 is a carrier for this X-linked trait. A typical  Xa chromosome is attached to the unaffected father (I-1), so the chance of carrier II-5 is 1/2. Probability of an affected son = 1/2 (probability II-5 is a carrier) x 1/2 (probability II -5 contributes (X^A) x 1/2 (probability of Y from father II-6) = 1/8. An affected daughter's likelihood is 0 because a typical X^A must be contributed by II-6.
  • The inheritance of the<u> dominant trait</u> is demonstrated by <u>Pedigree 3 </u>because affected children still have affected parents (remember that all four diseases are rare). The trait must be <u>autosomal dominant</u> because it is passed down to the son by the affected father. There is a 1/2 risk that the heterozygous mother (II-5) would pass on mutant alleles to a child of either sex for an autosomal dominant feature.
  • <u>Pedigree 4</u> is an <u>X-linked dominant function</u> characterized by the transmission to all of his daughters from the affected father but none of his son. On the mutant X chromosome, the father (I-1) passes on to all his daughters and none of his sons. As seen by his normal phenotype, II-6 therefore does not bear the mutation. An affected child's likelihood is 0.    

In the question the pedigree chart was missing ,hence it is given below.

     

7 0
3 years ago
What are the values in biological education ​
Scorpion4ik [409]

Answer:

Education has the greatest value. All those activities that are good, useful and valuable from educational point of view are considered as educational values. Ruskin, “Education does not mean teaching people to know that they do not know, it means teaching them to behave as they do not behave”.

Explanation:

6 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Please help please please :(
scoundrel [369]
Answer is….drumroll please A
6 0
2 years ago
Read 2 more answers
What might happen to the sea star population after oyster beds are destroyed
WINSTONCH [101]
Sea stars (or starfish) feed off the oyster beds. If the oyster beds were destroyed it would deplete the major food source of the sea stars and they would begin to diminish.
6 0
3 years ago
Other questions:
  • In facilitated diffusion, what helps nutrients cross the membrane wall
    10·2 answers
  • Which statements explain what will happen during the Asteroid Redirect Mission? Check all that apply.
    15·2 answers
  • Consider the following prediction.
    15·2 answers
  • Identify two organs or body features that are lateral to the navel
    8·1 answer
  • An increase in seawater density can be caused by a ________ in temperature or a/an ________ in salinity
    10·2 answers
  • How much of Earth's water is located in the oceans?<br> O A. 70%<br> OB. 80%<br> C. 55%<br> D. 95%
    15·2 answers
  • Carbohydrates provide the body with
    12·1 answer
  • A jogger has stepped in a pothole and sprained his ankle. What organ systems
    5·1 answer
  • If pathogen A is more resistant to an erythromycin disc on a Kirby-Bauer plate compared to pathogen B, then pathogen A will have
    7·1 answer
  • Which of the following statements about the effects of agricultural techniques on the environment is true?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!