1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
14

As part of an experiment to measure decomposition rates of different materials, students put food scraps from the cafeteria in c

ompost bin A and leaves and grass clippings in compost bin B for six weeks. Students in first period measured the temperature in bin A, and students in sixth period measured the temperature in bin B. What is the greatest error in the students' experimental design?
Biology
1 answer:
Yakvenalex [24]3 years ago
8 0
The greatest error in the experimental design is that the temperature of both bins were taken at different times from each other. The students should have measured them at the same time to lessen the randomness of the variables. A way to "fix" this is by changing taking into account the extra time between bin A was and bin B was measured for bin B's calculations.
You might be interested in
Based on Earth's geology what
Pavlova-9 [17]
A. stream erosion Just think about how the Grand Canyon was maid
8 0
3 years ago
Read 2 more answers
Which of the following best describes DNA in a prokaryotic cell?
Reil [10]
It is mRNA because it picks up the chromosome
6 0
3 years ago
HELP ME ASAP PLEASE.<br><br>How does water move from leaves to root? explain ​
iogann1982 [59]

Answer:

During transpiration, water will evaporate from tiny holes in the surfaces of leaves into the air (the tiny holes are called stomata). As the water molecules evaporate from plant leaves, they attract the water molecules still in the plant, helping to pull water up through the stems from the roots.

Hope this helps!    *please mark me as brainliest :)

6 0
2 years ago
Read 2 more answers
When the chromosomes line up in mitosis this is known as which phase?
Vera_Pavlovna [14]

Answer:

metaphase

Explanation:

This is where chromosomes meet in the middle (meta-middle) and line up

7 0
3 years ago
Finch species living on the islands exhibit a variety of beak types that favor different foods.finches that eat seeds and plant
mart [117]

Aye man just got it wrong twice because I couldn't find any answers anywhere. The answer is FINCH 4 (D)

4 0
3 years ago
Read 2 more answers
Other questions:
  • Many trees in a forest were cut down to make way for a new factory. Which three events could happen due to deforestation?
    9·2 answers
  • Which is avascular (lacks blood vessels)? epithelial tissue muscle tissue nervous tissue connective tissue all of the choices ar
    5·1 answer
  • some mutations always occur from generation to generation. But most mutations do not persist over time in the gene pool. Which m
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is a major difference between mitosis and meiosis I in a diploid organism?
    13·2 answers
  • 1. Which crystal system has the simplest structure?
    6·2 answers
  • Select the correct answer.
    10·1 answer
  • Which of the following forms of transport uses ATP directly?
    15·1 answer
  • - The part that is responsible for regulating involuntary processes in the body.
    13·2 answers
  • ASAP HELP!!! PLEASE ANSWER THIS!!! I GIVE COINS!!! I GIVE BRAINLIEST TOO!!!!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!