1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoray [572]
3 years ago
13

What is the meaning of sewage systemSewage System​

Biology
2 answers:
Mashcka [7]3 years ago
8 0
1. sewage system - facility consisting of a system of sewers for carrying off liquid and solid sewage. sewage works, sewer system. facility, installation - a building or place that provides a particular service or is used for a particular industry; "the assembly plant is an enormous facility"
Anika [276]3 years ago
4 0
Sewerage system, network of pipes, pumps, and force mains for the collection of wastewater, or sewage, from a community. Modern sewerage systems fall under two categories: domestic and industrial sewers and storm sewers. Sometimes a combined system provides only one network of pipes, mains, and outfall sewers for all types of sewage and runoff. The preferred system, however, provides one network of sewers for domestic and industrial waste, which is generally treated before discharge, and a separate network for storm runoff, which may be diverted to temporary detention basins or piped directly to a point of disposal in a stream or river.
You might be interested in
Identify the MOST specific taxonomic level.
UNO [17]

Answer:

Species

Explanation:

Species is the most specific and basic taxonomic level of classification and also the basic unit of biodiversity. Species is defined as group of highly closely related organisms that mate or breed to produce fertile offspring. After species genus is specific, and mostly organisms names are identified by species names and genus names as in binomial nomenclature, all scientific names are derived from genus and species e.g. the scientific name of frog is <em>Rana tigrina, </em>here '<em>Rana</em>' is genus name that is always capitalized and '<em>tigrena</em>' is species name that starts with small letter but both are always written in italics or underlined.

7 0
3 years ago
How can the student identify the catalyst
sergiy2304 [10]
<span>the student could identify the catalyst by noticing the substance that makes a chemical reaction go faster. It will be written in a chemical equation. Example of Catalyst : - A corosion process of an iron will be faster if it exposed to Oxygen - A burning process will be a lot of faster if it mixed with oil.</span>
7 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Normal mitosis results in the formation of two nuclide that are genetically
Rama09 [41]

Mitosis creates two nuclei that are genetically identical.

5 0
2 years ago
A_______ is a deep valley on land that forms a divergent boundary.
Nostrana [21]
A rift valley is a deep valley on the land that forms a divergent boundary.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Two heterozygous red flowers (white flowers are recessive) are crossed
    15·1 answer
  • Plants, algae, and some bacteria use the energy of sunlight in the process of
    6·1 answer
  • What do astronomers use too calculate the age of the universe?check all dat apply?
    15·2 answers
  • Select the correct statement about chemical energy, a term used by biologists to refer to potential energy available for release
    5·2 answers
  • Disturbances to an ecosystem, such as fires and floods, are often seen as negative. Describe a situation where
    9·1 answer
  • What role does cellular respiration play in the carbon cycle
    6·2 answers
  • Which is an agent of chemichal weathering that prouduses week acids that dissolves rocks
    8·1 answer
  • Tipo de materia constituida por átomos de la misma clase
    10·1 answer
  • an animal can wound a tree by scratching away the bark. the tree can respond to the wound in many ways. the sap quickly covers t
    14·1 answer
  • In a recent survey of students who graduated from a large public high school, nine out of ten students reported that they passed
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!