1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EleoNora [17]
3 years ago
6

Why does water have polarity

Biology
1 answer:
alexgriva [62]3 years ago
6 0

When the two hydrogen atoms bond with the oxygen, they attach to the top of the molecule rather like Mickey Mouse ears. This molecular structure gives the water molecule polarity, or a lopsided electrical charge that attracts other atoms.

You might be interested in
If the circumference of a circle is changed from 2 cm to 6 cm, how will the diameter change?
Alik [6]

Answer:

A. increases by a factor of 3

Explanation:

7 0
3 years ago
The magnetic force field around the earth that protects us from the solar wind:
dem82 [27]

Answer:

it is the vector b hope this helps

Explanation:

8 0
3 years ago
Which type of fermentation is better for a biological system ethanol fermentation or lactic acid fermentation? Justify answer wi
Ivenika [448]

Answer:

Lactic acid fermentation

Explanation:

When sugars are broken down to energy and lactic acid in animal tissues and in microorganisms it is referred to as lactic acid fermentation. Unlike alcoholic fermentation, lactic acid can be further broken down to release the locked up energy should oxygen be made available.

8 0
3 years ago
1. What is apoptosis and what does it have to do with cancer cells?
sammy [17]

Answer:

1.Apoptosis in Cancer

The loss of apoptotic control allows cancer cells to survive longer and gives more time for the accumulation of mutations which can increase invasiveness during tumor progression, stimulate angiogenesis, deregulate cell proliferation and interfere with differentiation [2].

2.BCL-2 family proteins are the regulators of apoptosis, but also have other functions. This family of interacting partners includes inhibitors and inducers of cell death. Together they regulate and mediate the process by which mitochondria contribute to cell death known as the intrinsic apoptosis pathway.

3.

Explanation:

Im sorry that only i can answer :<

But hope it helps! Correct me if I am wrong :>

Im sure about my answer :>

I

5 0
3 years ago
Traits, or characteristics, that organisms develop and are passed down to become new species are called _______ traits.
user100 [1]
Answer: inherited traits
7 0
2 years ago
Other questions:
  • A microscope has different magnification powers. Using the If . . . , then . . . format, write a hypothesis that answers the lab
    8·2 answers
  • In general, why might cell-wall inhibiting antimicrobial drugs be less effective on gram-negative bacteria compared to gram-posi
    9·1 answer
  • What layer of the skin is composed of fatty tissue and serves as an insulator for the body?
    10·1 answer
  • Which of the following are found in DNA and RNA?
    6·1 answer
  • what is a mineral deposited from which metals and nonmetals can be removed profitably ( it's a 4 letter word) (starts with o)​
    7·1 answer
  • The Alligator and the Python are competing for top predator. What affect can the introduction of a non-native species have on an
    11·1 answer
  • Will mark brainliest ⚠️⚠️ please help
    11·1 answer
  • In an attempt to increase diversity in your local public health department workforce you decide to obtain more information from
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • How do endocrine hormones reach their target cells?.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!