1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balandron [24]
3 years ago
10

Organic compounds contain bonds between what types of atoms?

Biology
1 answer:
Mamont248 [21]3 years ago
4 0

Answer:

It would be D

Explanation:

You are on the right track, but D is bascially what everything has to be made of.

You might be interested in
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
The process whereby cells develop with specialized structures and functions is
GrogVix [38]

Answer:

Differentiation

Explanation:

Cell differentiation occurs when stem cells become specialized cells

4 0
3 years ago
8. A research firm using genetic engineering techniques is able to grow a new variety of rice that
EastWind [94]

Answer:

b

Explanation:

4 0
3 years ago
O avoid compromising your car's aerodynamic properties, you should avoid ________.
Len [333]

Answer:

to carry heavy load on the vehicle's outside

Explanation:

Aerodyanmic properties of a car refer to its interactions with moving air and the properties which govern smooth movement of the car through air. Aerodynamics of a car address the concerns like lowering noise emission, prevention of heavy load and avoiding the luggage dragging.

Now when there will be great load outside the car,the air will resist the movement of car more, so it will be difficult for the car to cut through the air. Moreover, when a car carries huge amount of load outside its body, the frictional force by aerodynamic drag increases greatly. This can badly effect the performance of high speed cars like sports cars but for other normal cars it poses less hazards.

Hope it helps!


8 0
3 years ago
Training a dog to respond to the word "good" as a conditioned reinforcer is accomplished by saying "Good"
Alina [70]
The correct option is C.
Primary reinforcer refers to the basic needs of an animal, such as food, water, shelter, etc. Secondary reinforcer, which is also called condition reinforcer refers to the condition in which a stimulus reinforces a behavior after it had been associated with a primary reinforcer.
In the question given above, the primary reiforcer is food.


7 0
3 years ago
Other questions:
  • explain how Copernicus concluded that stars were farther away than planets. draw a diagram showing this principle to another exa
    5·1 answer
  • What mechanisms do plants use to load sucrose
    15·1 answer
  • According to the model, what is the role of RNA in DNA replication? A) RNA has no role in DNA replication B) RNA acts as a prime
    6·2 answers
  • The _________ variable in an experiment could be informally called the 'cause', while the ____________ could be called the 'effe
    15·2 answers
  • Write a paragraph in your science journal that explains why you can step out of the shower into a warm bathroom and begin to shi
    14·1 answer
  • How do you think Homeostasis of an organism and cell transport are connected?
    10·2 answers
  • Which component is found in nonvascular plants?
    12·1 answer
  • Which sends water from the roots to the rest of the plant?
    12·2 answers
  • What is the Advantages of boundaries of competence ethics
    8·1 answer
  • How has dna technology led to advancements in forensics medicine and agriculture?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!