1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margaret [11]
3 years ago
12

How many hydrogen atoms are found in the two molecules of hydroxylamine 2NH2OH

Biology
2 answers:
vampirchik [111]3 years ago
7 0

<u>Answer:</u> There are 6 hydrogen atoms present in 2 moles of hydroxylamine.

<u>Explanation:</u>

Hydroxylamine has a chemical formula of NH_2OH

This compound is formed by the combination of nitrogen, hydrogen and oxygen atoms.

In 1 mole of hydroxylamine, 1 mole of nitrogen atom, 3 moles of hydrogen atom and 1 mole of oxygen atom is present.

So, in 2 moles of hydroxylamine, (2\times 1)=2 moles of nitrogen atom, (2\times 3)=6 moles of hydrogen atom and (2\times 1)=2 moles of oxygen atom is present.

Hence, there are 6 hydrogen atoms present in 2 moles of hydroxylamine.

Nat2105 [25]3 years ago
3 0
1 molecule of hydroxylamine contains (2+1) hydrogen atoms. i.e, 3 atoms. So, 2 molecule contains 2×3 atoms of hydrogen. i.e, 6 atoms of hydrogen.
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What type of boundary is at letter C?<br><br> O Divergent<br> O Convergent<br> O Transform
tangare [24]
B


A convergent boundary is an earth where two or more lithospheric plates collide
7 0
2 years ago
Which compound has the highest fuel value ? Why?​
Semenov [28]

Answer:

Hydrogen gas has the highest calorific value of 150 KJ/g among all the fuels. So, hydrogen gas is considered to be an extremely good fuel.

Explanation:

6 0
2 years ago
Read 2 more answers
What is the difference between an endoskeleton and a exoskeleton? What types of animals have each?
dsp73

Answer:

an endoskeleton is a skeleton on the inside of a living creature. look at endo like enter, its on the inside! an exoskeleton is on the outside of a living creature. think of exo as exit, its on the outside! animals with endoskeletons are like dogs, cats, fish, and raccoons. animals with exoskeletons are like spiders, ants, crabs, and snails.

please give brainliest :)

3 0
2 years ago
The parathyroids are responsible for regulating proper levels of which elements in the blood?
blondinia [14]
Phosphate and calcium
3 0
3 years ago
Other questions:
  • What is the formula for cellular aerobic respiration?
    12·1 answer
  • Which element of the scientific process includes the most specific type of information about a living thing?
    6·1 answer
  • PLEASE HELP!! WILL MARK BRAINLIEST!!! This occurs when 2 or more organisms or populations in a community rely or need similar li
    14·1 answer
  • Imagine walking through a tropical rainforest. You notice that there are different types of trees, birds, insects, and other org
    6·2 answers
  • A response that is uniquely directed against pathogenic bordetella pertussis would involve what component?
    12·1 answer
  • How many parent isotopes based on half lives
    14·1 answer
  • Parent
    5·2 answers
  • The graph below shows population data for two species.
    10·1 answer
  • I need help to get the right question because i got it wrong
    7·1 answer
  • 49. How is air drawn into the body?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!