1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
4 years ago
8

Jessica Grayson is a secretary at Washington High School. She is in charge of ordering janitorial supplies from Joe's Cleaning C

enter. Jessica is also authorized to write and sign the checks for these supplies. Jessica is friends with Jake Emerson, who works at Joe's. Once a month, Jessica writes an order for $300 worth of supplies that the school really doesn't need. Jake signs the business manager's name from Joe's on the checks and gives them back to Jessica. She cashes the checks and deposits them into her own savings account. Jake makes sure the supplies are never delivered to the school. Are Jessica and Jake both committing a crime? If so, what crime(s)?
Law
1 answer:
r-ruslan [8.4K]4 years ago
6 0

Answer: Jessica = Embezzlement

Jake = Forgery

Both = Conspiracy

Explanation:

• Jessica,s crime is embezzlement.

Embezzlement is when an individual misappropriates the fund that has been entrusted and placed in the person's care. In this case, Jessica steals the company's fund that is in her possession and this is a financial fraud.

• Jake's crime is forgery

Forgery is when a take signature, false document, or something else is being copied so as to deceive someone else. This is punishable as the person will be charged with fraud.

• The crime of both of them is conspiracy.

A conspiracy is simply when there is an agreement that takes place between two or more people when they want to commit a crime. In this scenario, both Jake and Jessica agreed to carry out the fraud.

You might be interested in
More than 90% of officers killed in the line of duty die as a result of felonious attacks by criminals.
zmey [24]

It is a false statement that more than 90% of officers killed in the line of duty die as a result of felonious attacks by criminals.

<h3>What is the meaning of felonious attacks?</h3>

As a crime, a felonious assault means any sort of attack or threat of attack on another individual in which the attacker uses a dangerous weapon and seeks to cause serious harm but however stops short of an attempt to kill the victim.

These attacks on Police officers does not constitute to why 90% of officers killed in the line of duty die, rather, the causes are accidents, illness, old age etc. Therefore, the statement is a false statement.

Missing options True/False

<h3 />

Read more about attacks

brainly.com/question/28866933

#SPJ1

5 0
1 year ago
Talk at seven I am free than
Sedbober [7]

Answer:

L.M.A.O ok

Explanation:

5 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
What would be the hardest thing to deal with when you are a forensic scientist, collecting evidence or securing a crime scene? A
e-lub [12.9K]

Answer:

the hardest thing to deal with is people  that are with you will sometimes get your head messed up so make sure your partner is someone who can help you

8 0
3 years ago
What does Arrow's theorem teach us about Democratic elections?
NARA [144]
Everyone gets a say, everyone has a voice even if u can’t speak, also it’s a fair choice on elections
4 0
3 years ago
Other questions:
  • How are school rules similar to state and federal laws? What would the typical American high school be like if there were no rul
    9·1 answer
  • In the Katz vs United States case what is the constitutional issue involved in this case
    9·1 answer
  • Pharmacy technicians have access to patients’ health information and must remain compliant with HIPAA laws. Provide one example
    5·1 answer
  • Among adolescents and adults, alcohol use is involved in up to 70% of deaths
    8·2 answers
  • Commercial Law definition ​
    13·1 answer
  • Relacion folklore y nacionalismo
    13·1 answer
  • What is critical justices funnel? 3 sentences IN YOUR OWN WORDS.
    8·1 answer
  • Which is not a helpful hint for allowing a victim to regain control?
    12·2 answers
  • 3. While seem by some as a way to get rich, the
    9·1 answer
  • Because teens can obtain tobacco illegally, ____ are being removed from unsupervised areas.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!