1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
3 years ago
9

What is the study of biology defined as

Biology
2 answers:
ValentinkaMS [17]3 years ago
5 0
The science and study of life and living organisms
svetoff [14.1K]3 years ago
4 0
The study of living organisms, divided into many specialized fields that cover their morphology, physiology, anatomy, behavior, origin, and distribution.
You might be interested in
Give the correct which changes the given organisms are seen in order of their lifespan:
TEA [102]

Answer:

banyan tree --- parrot--- crow--- parrot.

3 0
3 years ago
HELPPPPP LOTS OF POINTS
ZanzabumX [31]

Answer:

B

Explanation:

its literally a cell law .-.

3 0
3 years ago
Read 2 more answers
BRAINLIEST ANSWER TO FIRST COMMENT
LiRa [457]
Different ORGANISMS!
6 0
3 years ago
(4. Synthesize How did Darwin's
zysi [14]

Answer:

Darwin observed marine fossils in the mountains and the uplift of land by an earthquake which supports Lyell's theory.

Explanation:

  • Lyell's theory  of an ancient Earth states "the formation of Earth's crust took place through countless small changes occurring over vast periods of time".
  • So Darwin had an observation of marine fossils that uplifted the land through many years by earthquake. Which was the same thing Lyell's explained.
  • According to known natural laws, It takes lots of time to form the earth's crust.
8 0
3 years ago
Recycling:
MArishka [77]
Most likely A because D is incorrect, not C because recycling says recycling glass is too expensive to do, and not B because it is effective
4 0
4 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which type of organism creates the original source of energy for nearly every ecosystem on Earth?
    15·2 answers
  • What is the relationship between the cytoplasm and nucleus of a cell
    6·1 answer
  • _______ ________ is a clear, watery fluid that is continuously produced by the ciliary body.
    11·1 answer
  • Please help me answer this 5 questions i mark you as brainlist
    9·1 answer
  • Which of these statements is true for restriction enzymes? each restriction enzyme is able to make a staggered cut at its recogn
    6·1 answer
  • Mrs. b is a 30-year-old african american woman with two children. she is employed at a workplace that does not provide the emplo
    15·2 answers
  • What is the greatest source of carbon that enters the ocean
    10·1 answer
  • Why wasn’t oxidation type chemical weathering common more than 2 billion years ago
    8·1 answer
  • The phase of mitosis that is characterized by the formation of chromatids is<br> ___
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!