1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gemiola [76]
3 years ago
12

The nurse applies a bandage to a patients hand. what should the nurse assess

Biology
1 answer:
STatiana [176]3 years ago
4 0
The little cotton things that absorbs the blood
You might be interested in
Why do plants need to control the loss of water how is this done?
Serga [27]

<span>Transpiration is the major way by which plants loose water (95%). It occurs through the stomata. Water loss is essential for plants because it releases the pressure, aids continuous intake of water by the plant, and allows the water to move to other parts of the plant that need water. Water loss through transpiration is regulated by Guard cells, which help prevent plants from drying out by regulating the opening & closing of the stomata, thus regulating the flow of the water vapor from the leaf tissue.</span>

5 0
3 years ago
Biologists have classified broader groups of life forms into super kingdoms that are known as what
andreev551 [17]
Biologists call those groups DOMAINS
3 0
4 years ago
4/5 + 2/3 equals what
BigorU [14]

Hey there!

We need to find a common denominator.

5*3= 15

4/5= 12/15

2/3= 10/15

12+10=22

22/15

or

1 7/15

I hope this helps!

~kaikers

7 0
3 years ago
Read 2 more answers
Natural selection is an example of a mechanism of evolution. Does this mechanism produce a change in INDIVIDUALS OR POPULATIONS
Veronika [31]

produces a change in populations.

8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • What are three characteristics of carbon that make it a unique element?
    15·2 answers
  • Hydrogen Bonds are weak, but they hold water molecules together and are difficult to break. Which one of the following images co
    10·2 answers
  • What occurs when one cannot move certain parts of the body
    12·2 answers
  • Which of the following is true about light absorption in plants?
    8·1 answer
  • What are the ways a lack of water could affect the function of a cell?
    11·2 answers
  • The lowest number of pathogens or pathogen produced products that can be detected is a measure of __________. view available hin
    7·1 answer
  • Which of the following uses CO2 fr carbon and H2 for energy?
    8·1 answer
  • suppose a dominate allele (N) codes for a big nose and recessive allele (n) codes for a small nose. Imagine that an organism rec
    13·1 answer
  • Two populations with different environments and different selection pressures are likely to experience which of the following?
    11·1 answer
  • Which of The following substances below is match with its correct organic group: A)monosaccharides- nucleic acids B) DNA-lipids
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!