1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DENIUS [597]
4 years ago
3

Explain why and how theories may be changed or replaced over time.

Biology
2 answers:
slega [8]4 years ago
6 0
<span>Theory is an unproven best guess at answering a question. Over time, people tweak the theory until it fits every possible situation it can be a part of, through publishing scientific findings and eventually coming to a complete conclusion that becomes scientific law. </span>
gayaneshka [121]4 years ago
6 0

Answer:Theories may be changed over time as new information is discovered or new technologies are developed. New developments lead to changes in experimental methods, which provide information that may or may not support the existing theory. If the theory is still supported, it may be updated. If it is not supported, but the results are true and relevant, the theory may be replaced.

You might be interested in
4. Which of the following was the key point of Darwin and Wallace's theory of evolution by natural selection?
Gnesinka [82]

Answer:

variation

Explanation:

he was trying to produce different types of species from over time they cross-breed and make a new type of bird.

^-^

6 0
3 years ago
Which of the following flower tissues is sterile?
Y_Kistochka [10]
<span>c. sepal is sterile. i hope you know what sterile is :)</span>
3 0
4 years ago
Read 2 more answers
Which environmental changes occur fastest?
IceJOKER [234]

Answer:

The answer is B

Explanation:

Hope this helps!

5 0
3 years ago
Read 2 more answers
What is a description of the central nervous system?
lisov135 [29]
D. The CNS is composed of the brain and the spinal cord.

Hope this helps! :)
5 0
3 years ago
What happens when a chlorine atom gains an electron in its outer energy shell?
emmainna [20.7K]

Answer: A.

Explanation: When a chlorine atom gains an electron, its outermost principal energy level achieves an octet. In this case, the ion has the same outermost shell as the original atom, but now that shell has eight electrons in it.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Living things should not be viewed under a(n) _____ because the preparation process would kill them
    6·2 answers
  • Which number represents the kinetic energy of a 1.0 kg billiard ball that moves at 5.0 m/s?
    11·1 answer
  • After months of heavy rains, a farmer noticed a steady drop in crop production. Upon testing the farmland, it was found the soil
    8·1 answer
  • Which cellular process is responsible for bringing solar energy into ecological pyramids?
    10·1 answer
  • Why is the process of<br> meiosis significant for<br> humans?
    7·1 answer
  • Which of the following could be an observation in an investigation?
    8·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Which sequence best explains the relationship between DNA and protein structure and function?
    7·1 answer
  • 5(a+4)-6a+1=12 plz help its due today
    12·2 answers
  • A bacterial cell exhibiting chemotaxis probably has.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!