1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bonufazy [111]
3 years ago
15

Which physical characteristic of the neonate is typically present in the neonate of a primigravid mother?

Biology
1 answer:
Montano1993 [528]3 years ago
4 0
Head moulding. Although, head moulding is common in any vaginal delivery, for a primigravid, which is having a child for the first time, is much more significant. The bones of a neonate are soft, flexible, and present gaps between them. These gaps and softness of the bones allow the moulding of the head when going through the vaginal canal. Being the first birth the vaginal canal is tighter and does not dilactate so well leading to a more significant head moulding.
You might be interested in
Which of the following is a trait that links modern primates into a single taxonomic group?
swat32

Answer:a. Retention of five functional digits on the tore and hindimbs

Explanation:

The presence of five digits or pentadactyly on the fingers as well as on the toes makes the primates distinct from other mammals. Also the keratin nails are present on each digit makes these organisms distinct from other mammals.

The five digits on the hindlimbs helps in grip of objects and on toes helps in climbing.

6 0
3 years ago
DhsvsgdhdbsghhJDBDYSUSBj HELP MEE​
krok68 [10]

Answer:c

Explanation:

8 0
2 years ago
Read 2 more answers
Lions, giraffes, and zebra occupy the tropical grassland, also known as the ______.
lakkis [162]
Savannah is the answer you are looking for here.
4 0
3 years ago
A chef fills a 40 mL container with 30 g of cooking oil. What is the density of the oil?
Nonamiya [84]

Answer:

So 1 ml=1 cm^3, so 40ml is 40 cm^3

D= m/v

density = 30/40

Density of oil is 0.75 g/cm^3 (which is verified as oil is less dense than water hence floats on it)

Explanation:

8 0
2 years ago
Which of the following is not being undertaken to reduce the risks to human health from pesticides?
Andru [333]

<span>Pesticide use is harmful to human agriculture because it contains an antifreezing chemical (present in transportation vehicles). When the chemical seeps into the leaves of the plant, it is distributed all over its body and remains there. The chemical may still be present there when we are going to the plant.</span>

4 0
3 years ago
Read 2 more answers
Other questions:
  • Please select the word from the list that best fits the definition
    7·2 answers
  • Please help, what is a good topic sentence for a DNA paragraph
    11·1 answer
  • The term "baby boom" refers to a significant increase in _______.
    11·1 answer
  • What cause's cell division
    11·1 answer
  • What if the function of bio molecules in the cell cycle?
    9·2 answers
  • All body cells contain identical DNA.- true or false
    14·2 answers
  • Anyone wanna help me ???????
    12·1 answer
  • In beans, the black color of the seeds (A) dominates over the white (a). When two bean plants were crossed with black seeds, pla
    10·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What is it called when two hormones cancel each other out or have opposite effects?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!