Flu vaccination can help you from getting sick with flu. Vaccine reduces the risk of infection by working with body’s natural defenses to help them safely develop immunity to diseases. If you get sick, flu vaccine will make your illness milder.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Studying cells helps us to construct better medicines and vaccines, which is beneficial to understanding life.
Answer:
Increase
Explanation:
Oligomeric enzyme have more than one polypeptide chain and the enzyme show positive cooperativity. It means that binding of the ligand to the enzyme will help other ligands to bind to the enzyme. Hill cofficient is used to measure the determining the degree of cooperativity of the binding between enzyme and substrate or ligand. As in this case, allosteric enzyme show positive cooperativity, its Hill cofficient will increase
A food web demonstrates which organisms transfer energy to other organisms. It helps maintain the ecosystem because if one life form went extinct, it could destroy the whole web.
