1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sveta [45]
3 years ago
13

What is the purpose of a pun err square

Biology
2 answers:
lidiya [134]3 years ago
6 0
The Punnett square is a square diagram that is used to predict the genotypes of a particular cross or breeding experiment:)
Elan Coil [88]3 years ago
4 0

Answer:

It is used to make predictions about the likelihood of certain traits occurring in offspring based on the genetics of the parents.

(Did you mean punnett square?)

Hope this helps and is correct!

You might be interested in
Esperanza watched as her mother got her flu shot. “Why do you need a shot if you’re not sick?” she asked. “So I won’t get sick,”
topjm [15]
Flu vaccination can help you from getting sick with flu. Vaccine reduces the risk of infection by working with body’s natural defenses to help them safely develop immunity to diseases. If you get sick, flu vaccine will make your illness milder.
8 0
4 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
How does studying cells help us to understand life?
Marina CMI [18]
Studying cells helps us to construct better medicines and vaccines, which is beneficial to understanding life.
6 0
1 year ago
An oligomeric enzyme transitions from a T to R state as substrate binds, producing positive cooperativity. If a heterotropic all
V125BC [204]

Answer:

Increase

Explanation:

Oligomeric enzyme have more than one polypeptide chain and the enzyme show positive cooperativity. It means that binding of the ligand to the enzyme will help other ligands to bind to the enzyme. Hill cofficient is used to measure the determining the degree of cooperativity of the binding between enzyme and substrate or ligand. As in this case, allosteric enzyme show positive cooperativity, its Hill cofficient will increase

6 0
4 years ago
How is looking at a food web a good way to understand interactions between organisms?
amm1812
A food web demonstrates which organisms transfer energy to other organisms. It helps maintain the ecosystem because if one life form went extinct, it could destroy the whole web.
3 0
3 years ago
Other questions:
  • 30 points. Science natural resources
    11·2 answers
  • What can you conclude about the structure of mitochondria?
    9·1 answer
  • A family can share a genetic risk of developing cancer if:
    8·1 answer
  • Major subdivisions of the biosphere are
    9·1 answer
  • What type of skeleton (ENdoskeleton, EXoskeleton, or None) do sponges have
    11·1 answer
  • What might be a use for fluorescence in situ hybridization (FISH)?
    9·1 answer
  • PLSSSS HELPPPP I WILLL GIVE BRAINLIEESTTT!!!!!!!!!! PLSSSS HELPPPP I WILLL GIVE BRAINLIEESTTT!!!!!!!!!!
    15·1 answer
  • Is it <br> A.True<br> B. False
    10·2 answers
  • How are stromatolite fossils evidence of earths early life?
    15·1 answer
  • Which biologically-based therapy uses a drug to remove toxic amounts of
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!