1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
2 years ago
8

NEED THIS QUICKLY PLZ! What is the function of a leaf’s cuticle?

Biology
2 answers:
Black_prince [1.1K]2 years ago
8 0
A plant cuticle is a protecting film covering the epiderms of leaves, young shoots and other other aerial plant organs with out periderm. It consists of lipid and hydrocarbon polymers impregnated with was and is synthesized exclusively by the epidermal cells.
stepan [7]2 years ago
3 0

Answer:

to reduce water loss and maximum light penetration

You might be interested in
List the ways how you can help make your commumity safe and healthy.<br>1.<br>2.<br>3.<br>4.<br>5.​
8_murik_8 [283]
1.) Follow the rules and laws in place which are meant to protect us.
2.) Alert the proper authorities when you know someone is not following the laws in place to protect us.
3.) If you see someone in danger help them however you can.
4.) Create a community watch group to prevent crime and ensure safety of those around us.
5.) Have a free social distancing neighborhood workout group to keep people active during quarantine.
4 0
2 years ago
What does the nucleus of the cell contain?
Alex777 [14]

Answer:

DNA

Explanation:

6 0
2 years ago
The moon s phases are caused by
Sergeu [11.5K]

Answer:

The phases of the Moon depend on its position in relation to the Sun and Earth. As the Moon makes its way around the Earth, we see the bright parts of the Moon's surface at different angles.

Explanation:

4 0
2 years ago
Read 2 more answers
What is are amino acids????
Anon25 [30]

Amino acids are the monomers that make up proteins. Amino acids are made of a carboxyl group (Carbon, Oxygen, Hydrogen), an amino group (Nitrogen and two Hydrogen), and finally an R group which differs in each amino acid. That R group is what makes each amino acid different! They can also act as enzymes. Essentially enzymes act as biological catalysts and control the functions of the cell and build cells.

3 0
2 years ago
Which condition would most likely result in evolution
eimsori [14]

C. a green parrot has an allele for green feathers and an allele for blue feathers.

4 0
2 years ago
Read 2 more answers
Other questions:
  • Name the two types of vectors.
    6·2 answers
  • Which situation allows evolution doing gene duplication
    12·1 answer
  • The blue catfish was intentionally introduced into the James River, from the
    10·1 answer
  • I have a simple question about external variables. If I'm doing an egg drop experiment, and my teacher "chucks" it off of the ro
    14·1 answer
  • As a population grows past the ecosystem's ______ the size of the population will _____ until the size of the population stabili
    11·1 answer
  • What evidence do we have of Neanderthal intelligence?
    10·1 answer
  • Where are haploid cells<br> found?
    8·2 answers
  • Plss help Due today! 40 points and brainliest to best answer!! Help Plzzz!
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • SOMEONE PLEASE HELP ME OUT WITH THIS !!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!