Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
A hormone imbalance may occur if this feedback system has trouble keeping the right level of hormones in the bloodstream, or if your body doesn't clear them out of the bloodstream properly.
The answer is <span>Special RNA polymerase, peptidoglycan in cell walls, ester-linked fatty acids.
Bacterial cell wall consists of peptidoglycans, not of cellulose or chitin. They also have ester-linked fatty acids, like eukaryotes. Ether-linked fatty acids are characteristics of Archaea. Also, bacteria have special RNA polymerase, unlike Eukaryotes that have three different type of RNA polymerase.</span>
I believe the correct response is the third option. Have higher resolution that allows you to view smaller specimens.
Answer:
The answer is mass and distance.
Explanation: