1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
CaHeK987 [17]
4 years ago
7

The nursing student is preparing to ambulate an obese client. the rn is concerned about the student's ability to safely ambulate

the client. what would be the nurse's most appropriate action?
Biology
2 answers:
Anestetic [448]4 years ago
4 0
The most appropriate way to handle this situation is to help the client set weight loss goals for a month, working on their upper body if their incapable of moving their lower body. Have a diet plan set for that client when hospitalized of low sodium, low fat foods. And try to get that person to move now and then to see if their strength builds up after a couple of weeks. 

I hope I helped :)
pickupchik [31]4 years ago
3 0
The nurse should speak to the student or get someone to help them walk the patient to their destination if he or she is incapable.
You might be interested in
What is the function of the organelle identified in the picture
nordsb [41]

Answer:

An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body. Among the more important cell organelles are the nuclei, which store genetic information; mitochondria, which produce chemical energy; and ribosomes, which assemble proteins.

Explanation:

7 0
3 years ago
Identify what Jean-Baptiste Lamarck believed about traits such as large muscles that are acquired during one's lifetime.
denis23 [38]
<span>What did Jean-Baptiste Lamarck believe about traits such as large muscles that are acquired during one's lifetime?

</span><span>They can be passed on to offspring.
</span>
<span>Jean-Baptiste Lamarck proposed that organisms have an innate tendency toward complexity and perfection.</span>
4 0
3 years ago
Prokaryotes have their chromosomes located in an area called the nucleoid.<br> a. True<br> b. False
g100num [7]

Answer:

True

Explanation:

Unlike eukaryotic cells, which have a nucleus that contains the genome and is separated from the cytoplasm by a membrane, the prokaryotic nucleoid is not membrane-bound and is not considered an organelle. The nucleoid is simply the area within a prokaryiotic cell where its DNA is located.

8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What gas to trees and other plants REMOVE from the atmosphere, which helps decrease global warming?
Svet_ta [14]

Answer:

Carbon Dioxide or CO2 is removed from atomsphere by trees and other plants through photosynthesis.

4 0
2 years ago
Other questions:
  • What sort of environment (hypotonic, hypertonic, isotonic) did the extra fertilizer create around the
    9·1 answer
  • The cross bridge cycle starts when _________.
    11·1 answer
  • Why does your pulse rate increase as your level of activity increases?<br><br>Please answer quick!
    13·2 answers
  • Which of the following pieces of evidence most strongly supports the idea that all life on Earth evolved from a single ancient c
    14·1 answer
  • How many Egg chromosome do cats,Onion,Guinea Pig,Cow,Chicken have?
    15·1 answer
  • What is able to lower the activation energy in a chemical reaction
    14·1 answer
  • What is a chromosome
    15·2 answers
  • Explain the processes of diffusion and osmosis and their roles within a cell? plss help with a thorough expliation
    11·2 answers
  • Which substance is the focal point of climate models such as sea ice, heat and salinity exchange, and phase changes?
    14·1 answer
  • Which of the following statements is true of density? *
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!