Answer:
An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body. Among the more important cell organelles are the nuclei, which store genetic information; mitochondria, which produce chemical energy; and ribosomes, which assemble proteins.
Explanation:
<span>What did Jean-Baptiste Lamarck believe about traits such as large muscles that are acquired during one's lifetime?
</span><span>They can be passed on to offspring.
</span>
<span>Jean-Baptiste Lamarck proposed that organisms have an innate tendency toward complexity and perfection.</span>
Answer:
True
Explanation:
Unlike eukaryotic cells, which have a nucleus that contains the genome and is separated from the cytoplasm by a membrane, the prokaryotic nucleoid is not membrane-bound and is not considered an organelle. The nucleoid is simply the area within a prokaryiotic cell where its DNA is located.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
Carbon Dioxide or CO2 is removed from atomsphere by trees and other plants through photosynthesis.