1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lianna [129]
3 years ago
6

The actual separation or division of the parent cell is called _____.

Biology
2 answers:
Anna71 [15]3 years ago
8 0
The separation or division of the parent cell is called cytokinesis
svetoff [14.1K]3 years ago
5 0

Answer:

The correct answer is Cytokinesis.

Explanation:

Cytokinesis is the last stage of the cell division that takes place at the end of M-phase (meiosis or mitosis). In this phase, the cytoplasm of the parent cell divides into 2 daughter cells.  It takes place after or during the division of the nucleus.

In the cell, in this process, a cell plate of cleavage furrow is formed that divides the cell membrane ultimately to form two new cells.

Thus, the correct answer is Cytokinesis.

You might be interested in
If a codon is mutated, say from GGU to CGU, is the same amino acid specified?
Mumz [18]
In the DNA structuring, there are four nitrogen bases involved that are combined in a structure containing diffrent bases. Each codon is unique to one another and represents another material. Since the two codons are not exactly the same, the answer is no.
6 0
3 years ago
Read 2 more answers
Land ___1___ includes human activities such as agriculture and construction. The modification of the Earth’s surface due to thes
MakcuM [25]
The correct options are as follows:
1. USE, B.
Land use refers to the function of a particular land, that is, what the land is been used for. For instance land can be used for agriculture, construction of roads, residential apartments, hotels, zoos, etc. Land use differs in the urban and rural settings. In the rural settings, land is usually used for farming and forestry while in the urban setting, land is usually used for construction purposes. 
2. LUC, OPTION B.
The modification of the earth's surface due to land use is called LAND USE CHANGE, LUC. A lot of changes occur when man use lands for different purposes. For instance, examples of land use change include: reduction in forest biomass, conversion of forest and grassland to pasture, etc,
6 0
3 years ago
Read 2 more answers
Why do some leaves turn from green to red, orange, or yellow in the fall?
11111nata11111 [884]

Answer:

Chlorophyll Breaks Down

Explanation:

because of changes in the length of daylight and changes in temperature, the leaves stop their food-making process. The chlorophyll breaks down, the green color disappears, and the yellow to orange colors become visible

U 2 can help me by marking as brainliest......

7 0
3 years ago
The head of a giraffe is 2.0 m above its heart and the density of the blood is 1.05 103 kg/m3. what is the difference in pressur
erastovalidia [21]
The giraffe head is higher than its heart so the blood pressure in the head must be lower than in the heart. The pressure is directly related to the density, gravity, and the height. The calculation would be:

<span>P = ρ*g*h 
</span>P= 1.05* 10^3 kg/m3 * 9.8m/s2 * 2m= <span>20 580 pascals= 20.58 kpa</span>
8 0
3 years ago
Which orgonelle is responsible for garbage disposal and recycling in an animal cell?
jarptica [38.1K]
The organelle responsible for keeping the cell clean is the cell membrane.
7 0
3 years ago
Read 2 more answers
Other questions:
  • WILL MARK BRAINLIEST!!!
    6·1 answer
  • Question 18
    11·2 answers
  • I need help with this Punnett square Practice
    9·1 answer
  • 1.)Which state withdrew the most groundwater in 2000? What is the greatest use of groundwater? Why is surface freshwater use gen
    5·1 answer
  • Hi again! TOO MUCH HW :( True or false: Do human fingers have muscles? If not what then?
    14·1 answer
  • Which of the following statements regarding membrane transport is false?
    10·1 answer
  • Earth science
    13·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Life Cycle of a Frog​
    10·2 answers
  • 48. The body's physical structure is supported by what system?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!