1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sineoko [7]
4 years ago
15

Which considerations are used to calculate a windchill factor? Check all that apply. wind speed air pressure wind direction air

temperature atmospheric heating
Biology
2 answers:
tatuchka [14]4 years ago
7 0

Answer: Wind speed and air temperature.


Wind chill factor is a factor which measures the loss of heat from the body due to the effect of low temperature air to which the body is exposed. This heat loss can be calculated by combination of factors like wind speed and air temperature that can be used to converted to a wind chill equivalent temperature or wind chill temperature. Higher the wind speed more will be the heat loss and lower the air temperature faster will be the cooling of the body. Therefore, wind speed and air temperature are considered for calculating the wind chill factor.

Naddika [18.5K]4 years ago
7 0

Answer).

Wind speed

air temperature.

You might be interested in
How do the properties of water contribute to transpiration
muminat

Answer:

Cohesion and adhesion of water molecules

Explanation:

Cohesion has to do with the ability of water to adhere together .

The cohesive properties of water which is occasioned by hydrogen bonding between adjacent water molecules allow the column of water to move up through the plant irrespective of the force of gravity as water molecules are evaporating at the leaf surface.

The adhesive properties of water, which means, the attraction between the water molecule and the xylem wall also ensure continuity in the movement of the water column in the xylem.

Hence the cohesive and adhesive properties of water molecules are important for transpiration to occur.

6 0
3 years ago
1. What interactions affect protons in an atomic nucleus? More than one answer may be correct.
irga5000 [103]
A=
In the nature there are four fundamental forces, namely nuclear force, electromagnetic force, weak force, and gravitational force. These forces are arranged with respect to their strengths in descending order.
The nuclear forces are of greater strengths.
These bind up the protons and the neutrons in an atom together. The nuclear forces are strong enough to combine the quarks that form the nucleons.

B= The weak forces of the interaction are the forces that are short ranged and cause the instability of the nucleus. These are 1/10^5 times of the nuclear forces.

C= The electromagnetic forces are the forces that which combine the atoms and the molecules that intend form the ordinary matter. The electromagnetic forces are 1/10^5times of the nuclear forces.

D= The gravitational forces are 1/10^5 times of the nuclear force.


If you have more questions let me know
5 0
2 years ago
Describe the complications that occur most frequently during calving, and recommend the best practices for assisting cows during
IceJOKER [234]

Answer:

Calving difficulty, technically called dystocia, is a major cause of death loss in cow-calf herds.

Explanation:

did research

6 0
3 years ago
Where do lipids, a class of organic compounds, fit on the hierarchy of biological organization? select the correct box?
Pavlova-9 [17]

Lipids are a class of organic compounds, which suits best under the column macromolecules on the hierarchy of biological organization.  

Biological organization refers to the hierarchy of composite biological systems and compositions, which illustrate life using a reductionistic method. The conventional hierarchy moves from an atom to more complex biospheres.  

Each of the level in the hierarchy signifies an enhancement in the organizational complexity, with each component being mainly comprised of the previous basic unit level.  


7 0
3 years ago
Read 2 more answers
as you read through the research in case study: sea turtles, keep in mind the three basic steps of addressing challenges to ecol
likoan [24]

Three question that are missing from given question are as follows:

Identify the problem(s) at hand.

Determine the cause of the problem(s).

Recommend solutions to the problem(s).

Answer:

The nesting area of ocean turtles could be saved and secured with the assistance of commitment of neighborhood individuals , maintaining a strategic distance from of beach fires during nesting season. Leave the enough beach area for the turtles to hatch their egg and nesting.

There ought to be negligible lighting close to the settling regions as arched turtles are attracted to light and they may wind up moving towards the city as opposed to the water. Local people could protect the hatching eggs from other wild creatures and winged animals by tagging them and keeping a nearby eye.  

Beach region should be cleanup as the debri are the significant reason forever danger to the turtles and all other marine creatures.  

8 0
3 years ago
Other questions:
  • Which of the following is an example of an internal influence?
    7·2 answers
  • A consumer that eat a variety of organisms, both plant and animals is called ___
    13·2 answers
  • In a solar eclipse the sunlight is blocked by?
    13·2 answers
  • Both male and female gametes are created during the process of meiosis. The formation of male gametes or sperm is called spermat
    13·2 answers
  • What can you conclude about fossil by looking at the layers of rock?
    9·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following factors limits the abilities of populations within an ecosystem to survive?
    7·2 answers
  • g When the weather changed drastically on the island of Daphne Major individuals with a particular beak size were more likely to
    12·1 answer
  • True or false.
    14·1 answer
  • Cells spend very little of their life performing mitosis. Most of a cell's life cycle is spent in interphase. Interphase is made
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!