1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
3 years ago
5

Consider the experiment in which the expression of two copies of the same gene are measured using the green fluorescent protein

reporter for the first copy of the gene and red fluorescent protein reporter for the second copy of the gene in E. coli cells. Provide an example of intrinsic versus extrinsic noise observed for this system.
Biology
1 answer:
Nat2105 [25]3 years ago
4 0

Answer:

Explanation:

Consider, for example, “shot noise” in a digital camera. ... Defining Extrinsic versus Intrinsic Noise in Transcription ...

You might be interested in
Which component of blood allows oxygen from the air to move from the lungs to cells of the body?
Margarita [4]
D) Red Blood cells
4 0
3 years ago
Read 2 more answers
Why do you think that planting new trees and plants is an important part of fighting against deforestation ?
butalik [34]

it is not because trees do not grow fast enough

5 0
3 years ago
17- Microorganisms which require 0-5.5 pH for the growth are:
GREYUIT [131]

Acidophiles is the correct

4 0
3 years ago
All you need to know is in the pic below
liubo4ka [24]
A is the answer. It’s like addition.
6 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST, 50 POINTS!!!
statuscvo [17]

Answer:

B

Explanation:

The Earth is tilted 23.5 degrees on its vertical axis. During the northern hemisphere's spring and summer, the northern hemisphere is tilted towards the Sun.

6 0
2 years ago
Other questions:
  • Being left-handed has been associated with an above average probability of having _____.
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The process in which the cell actually divides is called
    9·1 answer
  • Which type of stem cell can differentiate into the least number of types of cells?
    13·1 answer
  • A research biologist is studying cells from a new organism recently discovered in the Brazilian rainforest. She determines that
    8·1 answer
  • Once cells have specialized and are performing a specific function they cannot.
    13·2 answers
  • What is the function of mRNA?
    6·1 answer
  • Which statement is true of y chromosomes
    6·2 answers
  • What is the photosynthesis formula written in letters? <br><br> Helpp
    5·2 answers
  • Help me please <br> Earth and space
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!