1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
11

Ameoba moves by A. Pseudopods B. Cilia C. Flagella D. By water

Biology
2 answers:
Licemer1 [7]3 years ago
8 0

Answer A. Pseudopods

Explanation:

When an amoeba moves, its cytoplasm flows forward to form a pseudopodium.

hjlf3 years ago
6 0

Answer:

A. Pseudopods

Explanation:

Amoebae use pseudopodia to move

You might be interested in
What are two differences between DNA and RNA
Cerrena [4.2K]
Another difference would be that DNA contains the 5 carbon sugar deoxyribose while RNA usually contains the 5 carbon sugar of ribose. One differs from the other, as ribose has an additional hydroxyl group bonded to one of the carbon atoms, where as deoxyribose does not.
4 0
3 years ago
Peroxidase is a protein. What is this protein’s function, and how did it get its name?.
Olin [163]

Answer:

Most peroxidases are ferric heme proteins; one notable exception being the glutathione peroxidase, which is a selenium-containing enzyme. They are present in virtually all living species.

Protein has many roles in your body. It helps repair and build your body's tissues, allows metabolic reactions to take place and coordinates bodily functions. In addition to providing your body with a structural framework, proteins also maintain proper pH and fluid balance.

3 0
2 years ago
Describe animal interactions that affect populations in the tundra ecosystem. (Please help please... I have already had a mental
GenaCL600 [577]

Answer:

Herbivorous animals are unable to feed and end up migrating to other regions in search of food.

Explanation:

The tundra is a type of vegetation composed almost exclusively of mosses and lichens. This type of vegetation is found in regions with a polar climate. It is important to note that the tundra has a very fast vegetative cycle. That's because it freezes quickly and can be covered with ice all winter. This ends up modifying the lives of some animals that feed on this vegetation. These animals end up with unavailability of food and need to migrate to others in search of food.

5 0
2 years ago
What are strategies used by organisms to survive in an ecosystem ?
LenKa [72]

Answer:

Some animals have camouflage which helps them not get eaten.

Explanation:

3 0
3 years ago
Read 2 more answers
Unlike nonvascular plants, seedless vascular plants _____. grow rhgizoids that absorb nutrients have true leaves, stems, and roo
3241004551 [841]

Answer:

KSJXBOSN zjbs in i jainsjznj ksnisbib zone bzh jsizbizb jsibsibs

Explanation:

jjsib si jzjabjsb js sjbs isvjsh

4 0
2 years ago
Other questions:
  • This is a type of protein found in the cell membrane, which regulates the coming and going of substances into or out of the cell
    8·2 answers
  • A/an __________ may involve anything from a minimal exchange of information to extensive contact with the birth mother before an
    8·1 answer
  • Which can stimulate the production of red blood cells? hypoxia?
    12·2 answers
  • Sedimentary rocks are formed when soil, rocks, or the remains of dead organisms undergo layering and compaction over a long peri
    11·1 answer
  • Some cancers are caused by mutations that stop certain proteins from working. The inactivation of what kind of protein could lea
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which of the following processes is directly affected by the cardiovascular system? hair growth muscle strength healing of cuts
    15·2 answers
  • The atomic mass of an element whose atoms consist of elght protons, nine neutrons, and elght electrons is:
    13·1 answer
  • Which of the three things provide evidence that South America, Africa, Antarctica, and Australia were once together as one super
    6·2 answers
  • What will happen if Paramecium Sp is exposed to sunlight​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!