1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
4 years ago
13

Plz help ............. I have a test on this tomorrow

Biology
1 answer:
salantis [7]4 years ago
8 0
2.Uniformitarianism is events and catastrophism is changes. 3.relative dating is the age of rocks and geologic features compared with other rocks and features nearby and absolute age is to mean the numerical age. 4. The decay is the process by which an unstable element naturally changes into another element that is stable and dating is one important radioactive isotope used for dating. 5. Superposition is rock layers at the bottom and crosscutting relationship is a rock layer going though another rock layer
You might be interested in
Would all substitution mutations lead to a change in the amino acid sequence
Marysya12 [62]
No, because the genetic code is redundant.
6 0
3 years ago
Describe the difference plate boundaries?
Karolina [17]

There are four types of plate boundaries:  

Divergent boundaries -- where new crust is generated as the plates pull away from each other.  

Convergent boundaries -- where crust is destroyed as one plate dives under another.  

Transform boundaries -- where crust is neither produced nor destroyed as the plates slide horizontally past each other.  

Plate boundary zones -- broad belts in which boundaries are not well defined and the effects of plate interaction are unclear.

5 0
4 years ago
Help me plz I need help
Radda [10]

Answer:

The answer is C

Explanation:

Whenever a cell divides, it's always a carbon copy of the cell it originates from.

3 0
3 years ago
Help!!!!!!!! Pls help!!!!!!!!!
nignag [31]
Genotype of the Q gene is homozygous dominant
3 0
3 years ago
Read 2 more answers
Put these events of Earth’s history in the order that they happened: dominance of mammals, sharks and trilobites abundant in the
Ahat [919]
Development of the ozone layer
>> sharks and trilobites abundant in oceans
>> plants and animals colonize land
>> dominance of reptiles >> dominance of mammals
6 0
3 years ago
Other questions:
  • What is the most logical sequence of steps for splicing foreign dna into a plasmid and inserting the plasmid into a bacterium?
    8·1 answer
  • Oxygen carried in a hemoglobin molecule is bound to a/an
    10·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • How does the river erode the rock
    6·1 answer
  • ???????????????????????????
    12·2 answers
  • PlZZZ HELP ME ON MY SCIENCE TEST ASAP I NEED THIS
    9·1 answer
  • Can you please help me!? ​
    8·1 answer
  • When beach erosion occurs you have several events that take place depending on what environmental elements are involved .What el
    10·1 answer
  • I have a question about this video my teacher sent me, how do I find the variable in this?
    7·1 answer
  • Complete the T-chart by categorizing each statement as something that would most likely be relevant to gene flow or genetic drif
    16·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!