1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antoniya [11.8K]
3 years ago
14

What kind of food contains lots of carbohydrates?

Biology
2 answers:
Ludmilka [50]3 years ago
5 0
Potatoes have the most carbs.
Afina-wow [57]3 years ago
4 0
Potatoes, the others do not

You might be interested in
If you cross a mule and a horse, you get a donkey. How many chromosomes does a donkey have?
madreJ [45]

Answer:

62

Explanation:

31 pairs

A mule is the offspring of a male donkey (a jack) and a female horse (a mare). A horse has 64 chromosomes, and a donkey has 62. The mule ends up with 63. Mules can be either male or female, but, because of the odd number of chromosomes, they can't reproduce.

3 0
3 years ago
What is the most likely explanation for the results in the graph?
Delicious77 [7]

Answer:

B. The apple orchard releases toxic chemicals into the water of the  bay.

Explanation:

Option B is the correct answer. It is the most likely explanation for the results in the graph.

From the graph, we can see that the population of the fishes sharply dropped. Since the fertilizer is applied to the apple orchard and the orchard was planted beside the bay, during the rain it is possible that the water has washed some of the fertilizers into the bay. The chemicals used in making fertilizer are harmful and toxic.

This reveals that the toxic chemicals released from the apple orchard are responsible for the decline in the population of the fish.

7 0
3 years ago
Harold needs to format several cells with 11pt calibri font, two decimal places, right-aligned, and a blue font color. the most
emmasim [6.3K]
<span>Answer: Use Format Painter in Microsoft Office or in other such office automation softwares. Explanation: Since several cells have to be formatted with the same set of style, it is more easier if we do the formatting in one cell and then use the format painter tool to have the same formatting copy-pasting to all the desired cells.</span>
5 0
3 years ago
Trade winds blow from the horse latitudes toward the______.
Lostsunrise [7]

Answer:

the correct answer is the equator

5 0
3 years ago
The smallpox virus has the potential to be used as a biological weapon. Briefly explain.
egoroff_w [7]
A. Smallpox could make a good biological weapon because it is an airborne virus.

B. Smallpox can be prevented via vaccination and potentially prevented by HEPA filters.
3 0
2 years ago
Other questions:
  • 12. Normalmente, en el proceso de ósmosis, el flujo neto de moléculas de agua dentro o fuera de la célula depende de las diferen
    11·1 answer
  • Which receptor type is exemplified by opening a channel to let sodium into the cell?
    14·2 answers
  • Which combination of characteristics in a population would provide the greatest potential for evolutionary change?
    13·1 answer
  • Scientists rely on _____ concepts when researching crop production and medicine. biology physics geology astronomy
    10·1 answer
  • A close evolutionary relationship between annelids and mollusks is suggested by the presence of a _____ larva in both phyla as w
    13·1 answer
  • Some researchers have proposed that the human population was reduced to fewer than 10,000 individuals as a result of a catastrop
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What structure encloses almost all bacteria? Do bacteria have a structure that encloses the genetic material?
    5·1 answer
  • The growth patterns of plants such as ivy and pole beans are regulated by
    12·1 answer
  • Ron is observing an onion cell on a slide under a microscope. He sees chromatids being pulled to opposite ends of the cell. Whic
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!