All categories

3 years ago

Check all the characteristics below that describe Compounds

Biology

1 answer:

MrRa [10]3 years ago

3 0

Answer:

Two or more elements,

Two or more elements,Chemically combined elements,

Two or more elements,Chemically combined elements,More and definite proportions.

Explanation:

A compoundcan be definedas a substance which is composed of two or more elements, that are combined together chemically.

These constituents elements are present in definite proportion and quantities. The composing elements of a compound can be separated only by the means of chemical procedures. A compound is composed of more than one type of atom.

Hence answer could be:

Two or more elements,

Two or more elements,Chemically combined elements,

Two or more elements,Chemically combined elements,More and definite proportions.

You might be interested in

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

IgorC [24]

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations

5 0

3 years ago

The degree to which the findings of a study may be applied to a larger population represents how

maks197457 [2]

Answer:

Explanation:

4 0

3 years ago

Light energy is converted to chemical energy through the process of

elixir [45]

I think the answer is photosynthesis.

5 0

2 years ago

Read 2 more answers

Suppose a restriction enzyme recognizes the six-base sequence aagctt ttcgaa in a double strand of dna . Between which two nucleo

AfilCa [17]

Answer:

Explanation:

1. A restriction enzyme, restriction endonuclease, an enzyme that cleaves DNA into small fragments at or near specific recognition sites (different restriction enzyme has different restriction site) within molecules known as restriction sites.

2. Restriction enzymes are found in archaea and bacteria.

3 And in bacteria and archaea they provide a defence mechanism against invading viruses.

4. Each restriction enzyme cut at the specific site, because each restriction enzyme have specific recognition site.

3 0

3 years ago

Decomposers such as bacteria feed on dead plants and animals. In which cycle does this decomposition play a role in forming the

Vinvika [58]

It is the carbon cycle

4 0

3 years ago

Read 2 more answers