1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tensa zangetsu [6.8K]
3 years ago
7

Which two elements make up the most common compound in the human body

Biology
2 answers:
vampirchik [111]3 years ago
8 0
Almost 99% of the mass of the human body is made up of six elements: OXYGEN,CARBON,hydrogen,NITROGEN,calcium, and phosphorus. Only about 0.85% is composed of another 5 elements: potassium, sulfur, sodium, chlorine, and magnesium. Really hoped this helped.
Juliette [100K]3 years ago
3 0
The two elements that make up the most common compound in the human body are oxygen (O) at 65% and carbon (C) at 18%. I hope this helped!! Have a great day!! :)
You might be interested in
Which statement describes DNA​
Romashka [77]

Answer:

DNA stores an organism’s genetic code.

3 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
How does human evolution relate to the sensibility of disease
igomit [66]
Human evolution known to be a process in which species adapt to certain conditions of life, and in the battle of life and death, they are forced to become stronger in order to survive in the world. Diseases have always been present during the evolution, acting themselves as a natural selector-the weaker organisms get sick and die.
6 0
3 years ago
Why are beavers a keystone pecies
oee [108]
They construct dams and create an ecosystem for other species . Because of their dam building nests become available for birds, fish population increases and waterfowl population goes up
7 0
3 years ago
Please help me. I need more than just one example on this graded assignment. I'm stuck AF..
ryzh [129]
What do you need examples of?
4 0
3 years ago
Other questions:
  • In the chemical compound C2H2, how many pairs of electrons are shared between the two carbon atoms?
    10·2 answers
  • Some fungi secrete substances that are toxic to bacteria that compete with them for food. Scientists have used their knowledge o
    7·1 answer
  • 1. PLEASE HELP!!!!! (I will give you Brainliest if you can do them all!!!)
    12·1 answer
  • Darwin believed that organisms with traits that were best suited for the environment would
    5·2 answers
  • Florida is located in the
    11·2 answers
  • Identify the characteristic or function all roots have in common.
    14·1 answer
  • Explain what processes are going on in the picture? What do the numbers 1 and 2 mean?​
    6·1 answer
  • What four characteristics are best for an index fossil to have ?
    9·1 answer
  • 10 points for each valid answer! Thanks.
    9·1 answer
  • Why are some cells in the onion root tip undergoing mitosis?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!