4 years ago

What do plants in a tropical forest usually have

2 answers:

8 0

I would say fat leaves and tall trunks...Plants tend to grow toward the sunlight so a tall trunk would help it and for those who dont fat eaves would help it

attashe74 [19]4 years ago

5 0

Orchids. There are many types of rainforest orchid, s<span>ome have specially adapted roots that enable them to capture water and nutrients from the air.</span>

You might be interested in

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

mote1985 [20]

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

4 0

3 years ago

6) African cichlids are a group of closely related fish species. There are at least 500 known species living in three small lake

pogonyaev

It's ADAPTIVE RADIATION because it is <span>the diversification of a group of organisms into forms filling different ecological niches.</span>

3 0

3 years ago

Read 2 more answers

What information can you learn from electrophoresis

nadezda [96]

Answer:

DNA Sequencing.

Explanation:

In field of Biotechnology, we use an instrument known as "Gel Electrophoresis" in this instrument, different sized DNA Fragments are placed. After that, Electricity is applied due to which Negatively charged DNA fragments move towards positive charge through Gel Medium. Small sized DNA Fragments reach destiny before large fragments.

This is an application of Electrophoresis.

8 0

3 years ago

Column A

Zigmanuir [339]

Answer:

20 synthesis is correct because it is an active transport

4 0

3 years ago

What Is the function of the coded Instructions contained in the body cells of an organism

Talja [164]

Answer: The function of the coded instructions contained in the body cells of an organism is called the Genes

Explanation:

6 0

3 years ago