1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grin007 [14]
4 years ago
9

What do plants in a tropical forest usually have

Biology
2 answers:
aleksley [76]4 years ago
8 0
I would say fat leaves and tall trunks...Plants tend to grow toward the sunlight  so a tall trunk would help it and for those who dont fat eaves would help it
attashe74 [19]4 years ago
5 0
Orchids. There are many types of rainforest orchid, s<span>ome have specially adapted roots that enable them to capture water and nutrients from the air.</span>
You might be interested in
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
mote1985 [20]

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

4 0
3 years ago
6) African cichlids are a group of closely related fish species. There are at least 500 known species living in three small lake
pogonyaev
It's ADAPTIVE RADIATION because it is <span>the diversification of a group of organisms into forms filling different ecological niches.</span>
3 0
3 years ago
Read 2 more answers
What information can you learn from electrophoresis
nadezda [96]

Answer:

DNA Sequencing.

Explanation:

In field of Biotechnology, we use an instrument known as "Gel Electrophoresis" in this instrument, different sized DNA Fragments are placed. After that, Electricity is applied due to which Negatively charged DNA fragments move towards positive charge through Gel Medium. Small sized DNA Fragments reach destiny before large fragments.

This is an application of Electrophoresis.

8 0
3 years ago
Column A
Zigmanuir [339]

Answer:

20 synthesis is correct because it is an active transport

4 0
3 years ago
What Is the function of the coded Instructions contained in the body cells of an organism
Talja [164]

Answer: The function of the coded instructions contained in the body cells of an organism is called the Genes

Explanation:

6 0
3 years ago
Other questions:
  • Hey guys, can you please help someone out.
    6·1 answer
  • The effects of radiation on biologic material depend on several factors. If a large quantity of radiation is delivered to a body
    15·1 answer
  • Which tool would be BEST to accurately observe the details of organelles in a cell?
    11·1 answer
  • What are auroras made of?
    8·1 answer
  • Short segments of newly synthesized dna are joined into a continuous strand by _____.
    14·1 answer
  • A meal consisting of a cheeseburger, large fries, and a chocolate shake provides a total of 1120 kcal. Forty-eight percent of th
    5·1 answer
  • Explain why the genes make the cell growth controller. The protein synthesis indicator and the DNA repair protein are active in
    11·1 answer
  • Do you think this is a good pumpkin template
    13·2 answers
  • Are seals secondary consumers? if so do they eat phytoplankton?
    9·1 answer
  • The half — life of nickel is 96 years. How much of a 30-gram sample is left after 270 years?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!