1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
4 years ago
12

The history of the present illness (hpi) is documented in which section of the patient record?

Biology
1 answer:
NISA [10]4 years ago
6 0
The history of the present illness is documented in the MEDICAL HISTORY section of the patient's record. 
The medical history section contain information about all the diagnoses, medical care and treatment that the patient had received. These information help the current physician to have an idea of what has been going on concerning a patient's case in the past and he will documents his own observation in this section. 
You might be interested in
Which of the following contains the base Uracil?
Deffense [45]

Answer:

Both RNA and DNA

Explanation:

i took college physics (im 14 btw)

8 0
3 years ago
Base your answer on the diagram below which represents a microscopic view of a functional
Leona [35]

Answer:

Your question is poorly written, but I could still tell you that the functional unit of the kidney is the renal glomerulus, Bowman's capsule.

Explanation:

Bowman's capsule is the renal unit in the form of a hollow glans in which the substances to be excreted are filtered. It is located at the beginning of the tubular component of a nephron in the kidney of mammals. Enclosed within Bowman's capsule is the glomerulus.

8 0
3 years ago
What happens to the energy in an ear of corn once a cow eats it?
Dahasolnce [82]
Correct me if i'm wrong i think the best answer would be d. the cow uses all of the corn's energy for life processes.
3 0
3 years ago
Answer #14 and will mark brainliest
Sindrei [870]

Answer:

The populations of different artic animals would start to decrease because of the lack of land and food.

7 0
3 years ago
Cells occur at a range of sizes, but the components of which they are composed (biological macromolecules and other materials) d
IrinaK [193]
Charomomosomes ewswsssssssssssssssas
3 0
3 years ago
Other questions:
  • How many Angstroms are in a meter?
    13·2 answers
  • A major part of an ecosystem was washed away by a flood. Only two male deer and two female deer survived from the original popul
    13·1 answer
  • The plasma membrane is composed of a phospholipid bilayer with embedded proteins. What is one of the functions of the embedded p
    12·2 answers
  • • How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbari
    12·1 answer
  • Flowers may be solitary, as in a zinnia or dahlia, or appear in clusters or a/an _______________, as in a/an _______________. g
    7·1 answer
  • The study of involves the study of the natural world
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which one of the following is the correct answer ?
    13·1 answer
  • In meiosis, how does prophase i differ from prophase ii?.
    11·1 answer
  • __________ are the grooves or fissures that separate the sheets of nerve cells in the cerebral cortex.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!