1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
3 years ago
6

A new DNA strand elongates only in the 5' to 3' direction because A new DNA strand elongates only in the 5' to 3' direction beca

use replication must progress toward the replication fork. DNA polymerase can only add nucleotides to the free 3' end. DNA polymerase begins adding nucleotides at the 5' end of the template. Okazaki fragments prevent elongation in the 3' to 5' direction.
Biology
1 answer:
Svetllana [295]3 years ago
7 0

Answer:

The correct answer will be option-DNA polymerase can only add nucleotides to the free 3' end

Explanation:

DNA replication process produces the exact copy of DNA which requires various enzymes. The function of adding a nucleotide to the daughter strand is performed by the enzyme called DNA polymerase.

The DNA polymerase enzyme catalyses the process of DNA replication which requires energy provided by the dNTP. The enzyme adds new nucleotides at 3'-OH end of the DNA which favour the reaction energetically.  

Thus, the new DNA strand appears to be elongated in the 5' to 3' direction.

You might be interested in
Solar cells harness the sun's energy and convert it into electricity. However, the cost of this clean energy is much higher than
Dafna11 [192]

Answer:<u> Option D </u>

Solar panels contain a very expensive element, i.e. silicon. This element is able to convert the solar energy into electric energy. The cost of the solar panel gets expensive because of this rare element. It is found in limited areas of the world. That’s why option D is correct. Coal is not used in solar panel, so option B is incorrect. Neither is wind energy, so option A is also incorrect. Water is also not used for exploiting solar energy, which makes option C a wrong answer.

4 0
3 years ago
Read 2 more answers
Which animal adaptation happened before the others?
weeeeeb [17]

Answer:

D?

Explanation:

7 0
2 years ago
Read 2 more answers
What happens to the states of matter when the temperature changes
stepladder [879]

    They may either release heat or gain heat. With a temperature increase, the kinetic energy increases and the state of matter will increase (example, ice to water aka solid to liquid)

    If the temperature decreases, then the kinetic energy decreases and the state of matter will decrease (example, water vapor to water aka gas to liquid)

Have a nice day!

    I hope this is what you are looking for, but if not - comment! I will edit and update my answer accordingly. (ノ^∇^)

- Heather

6 0
2 years ago
The three types of variation
Likurg_2 [28]
There are three sources of genetic variation: mutation, gene flow, and sexual reproduction. A mutation is simply a change in the DNA.
3 0
3 years ago
It is believed the major reason for the decline in amphibian species is _______.
hichkok12 [17]
From my speculation it is loss of habitat and global warming
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these statements best explains why the star chart does not show the exact locations of the sun and planets?
    11·2 answers
  • How many homologous chromosome alignments are possible for independent assortment during meiosis?
    7·2 answers
  • What are two ways that prokaryotes provide nutrients to humans
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which joint is considered the most flexible joint in the body? Select to launch animation Which joint is considered the most fle
    10·1 answer
  • What must happen for the disease to spread from one person to another?
    13·1 answer
  • HELP!!!! 50PTS!!! AND WILL BE MARKED BRAINLIEST!!!!
    13·1 answer
  • Which type of potential energy is stored in the chemical bonds of a sugar molecule
    6·1 answer
  • What is a non example of just erosion?
    7·2 answers
  • Which of the following is not a possible cause for air pollution?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!