1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
13

What would happen to the nitrogen cycle if this step happen

Biology
1 answer:
Lisa [10]3 years ago
8 0

Please state the full question. Then I will answer it.

You might be interested in
The human body has many types of cells. For example, muscle tissue and skin have different kinds of cells.
oksian1 [2.3K]

Answer: OE

Explanation:

3 0
2 years ago
Consider the population of four juvenile condors their weights in pounds are
juin [17]
Their weights in pounds are 5, 7, 10, 11.
6 0
3 years ago
What poses a great threat to the entire human species;poisonous abiotic factors or poisonous biotic factors?
jolli1 [7]
Well, biotic factors are living things in an ecosystem such as animals or insects. Abiotic factors are non living things in an ecosystem such as sunlight or temperature. I would say biotic factors would be more harmful since this includes bacteria or other diseases, not many abiotic factors would pose a great threat to the entire human species. Hope this helped.
7 0
3 years ago
A car moves with an initial velocity of 15 m s-1 and accelerates with constant acceleration 4 m s-
timofeeve [1]
Initia Velocity(u) :- 15m/s

Acceleration(a) :- 4m/s2

Time Taken(t) :- 50 Seconds

{ok a formula is there —->>> s = ut + 1/2 at2(it is ‘t’ square)….. now we will write like this and yeah don’t write this}

We Know,

s = ut + 1/2 at2

s = (15*50 + 1/2 *4*50*50)m

s= (750 + 5000)m

s = 5750 m

Therefore distance traveled is 5750 meters.

Hopefully this helps
5 0
2 years ago
( The stem is the part of a plant that supports other structures such as flowers, fruits, and leaves. Which of the following is
Ostrovityanka [42]

Explanation:

Maybe.. to provide nutrients of Soil and Water...

3 0
2 years ago
Other questions:
  • The type of protein-energy malnutrition characterized by a general lack of protein in the diet is called __.
    5·1 answer
  • Enzymes are protein molecules, which are made of long chains of
    12·1 answer
  • C) Why are vaccines important in preventing infections of more dangerous viruses?
    15·1 answer
  • A scientist is studying specialized cells that help pump blood. Which cells is she most likely studying?
    7·1 answer
  • The nurse enters the room of a client with schizophrenia the day after the client has been admitted to an inpatient setting and
    15·1 answer
  • A female cat has two recessive genes for long fur (ss) and a male cat has two dominant genes for short fur (SS). What is the lik
    10·2 answers
  • Match the term to its definition (Hint: Look at the bottom of the article)
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Scientists compare the structures of a chicken embryo and a human embryo at the same stage of development. They find that both v
    8·1 answer
  • There is a species of frog on an island that puzzles scientists. The proportion of frogs with no stripes is greater than the pro
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!