1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
3 years ago
8

A mammal embryo worksheet. fill in the blanks with the correct answers. after two months of development, the embryo is called a

fetus. the ___ is formed in part from the inner lining of the uterus and in part from other membranes. it is through the placenta that that the embryo/fetus is nourished while in the ____ and _____ are carried away.
Biology
2 answers:
dezoksy [38]3 years ago
5 0
After two months of development, the embryo is called a fetus. The endometrium is formed in part from the inner lining of the uterus and in part from other membranes. It is through the placenta that that the embryo/fetus is nourished while in the umbilical cord and three blood vessels are carried away.

 

melisa1 [442]3 years ago
5 0
<h2>Embryo Fetus is Nourished </h2>

After two months of development, the embryo is called a fetus. The endometrium is formed in part from the inner lining of the uterus and in part from other membranes. It is through the placenta that that the embryo/fetus is nourished while in the umbilical cord and three blood vessels are carried away.


You might be interested in
which process is the total of all the chemical reactions in an organism? homeostasis migration metabolism respiration
Llana [10]
The answer is metabolism
3 0
3 years ago
Read 2 more answers
Vertebrates include fish, amphibians, reptiles, birds, and mammals. Analyze the common characteristics of reptiles and explain h
mario62 [17]
There are some differences, though. Mammals have hair all over their bodies, while reptiles have scales. Mammals have live births and produce milk for their young, while reptiles lay eggs. Reptiles have only three-chambered hearts, mammals have four
7 0
3 years ago
Explain what happens to the molecules as the water gets hot.
dezoksy [38]
When water is heated, it evaporates. The molecules move and vibrate so quickly that they escape into the atmosphere as molecules of water vapor.
6 0
3 years ago
Read 2 more answers
When you breathe onto a cold window and water droplets appear, it is an example of
Lena [83]
Condensation because the water droplets are being formed by the water vapor in your breath against the cold window makinng condensation due to the drastic temperature difference between your breath and the window
3 0
4 years ago
Read 2 more answers
A nonsense mutation has occurred, resulting in a truncated, nonfunctional product in the mutant. In a eukaryotic cell, a gene th
Ymorist [56]

Answer:

Removal of introns

Explanation:

the reduction in the sequence is as a result of the removal of introns. Introns are actually non-coding regions and do not code for proteins. they are usually spliced out.

7 0
3 years ago
Other questions:
  • A team of students encounters an unknown organism in a field while conducting a biodiversity study. Some students think the orga
    13·1 answer
  • PLS HELP!!!
    10·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • All __ are molecules, but only molecules made up of atoms from two or more elements are compounds.
    12·1 answer
  • PLZZ HELP!
    8·2 answers
  • Which condition causes ocean water salinity to decrease?
    5·1 answer
  • Select from the drop-down menu to correctly complete the statement.
    8·1 answer
  • Plzz Help! 20 points!!
    14·2 answers
  • Where are the bound ribosomes found?
    13·1 answer
  • Cyanide, raw sewage, petroleum from shipping accidents, and detergents are all examples of?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!