Answer:
Uracil "U"
Explanation:
RNA shares Adenine (‘A’), Guanine (‘G’) and Cytosine (‘C’) with DNA, but contains Uracil (‘U’) rather than Thymine.
There Are these big thick red walls In front of me I can't get around them I don't know what to do.Maybe I could chew through them they seem like intestines so they are going to be easy to get through. I just hope white blood sells aren't on there way like a giant white army of destroyers of the bad things like me. Ok now it's going to be a lot easier to get through the next layer of intestine since I got through the fist layer. Wow these layers of intestine are thick for me and supper stinky.
Ok now that I'm done with the first intestine I should keep moving up through the amine system. Are you kidding me more intestine how much dose this person have! This intestine is very slimy and gross o no the white blood sells are hear to kill me
<span>The ability of muscles to exert a force one time is called muscular strength. The correct option among all the options that are given in the question is the fourth option or option "D". The other choices can be easily neglected. I hope that this is the answer that has actually come to your great help.</span>
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
<span>a central carbon atom
a hydrogen atom
an amino group - consisting of a nitrogen atom and two hydrogen atoms
a carboxyl group - consisting of a carbon atom, two oxygen atoms, and one hydrogen atom
<span>an R-group or side chain - consisting of varying atoms
Reference used- </span></span>http://study.com/academy/lesson/what-are-amino-acids-definition-structure-quiz.html
