1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
14

Why do some people consider viruses to be alive

Biology
2 answers:
jeyben [28]3 years ago
5 0
Because they have some properties of life!
Mariulka [41]3 years ago
5 0
Because they grow and spread and some might think it’s a bacteria
You might be interested in
Which of the following is not a form of mass communication?
Ksenya-84 [330]

Answer:

D .job interview...........

6 0
3 years ago
Read 2 more answers
Plz help me answer this question!
Arte-miy333 [17]

Answer:

You will measure the rate of your pules and how fast its going.

You need to keep the thing you are doing for example( if your running you have to make the people run the same length as every one else.  

I hope this helps :)

Explanation:

3 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
{100 POINTS!}
Zinaida [17]

Answer:

B. Bacteria that carry out decomposition

Explanation:

This is your answer because these don't produce anything. These are things that don't produce their own food, but they eat something else. One example on land can be Mushrooms.

So hence, your answer is only B. Bacteria that carry out decompositon

Thanks!

Mark me brainliest!

3 0
2 years ago
In what two ways are active transport proteins similar to enzymes
Ksju [112]
  1. They change conformation/shape when the right molecule bind in their active site.
  2. They enable reactions to proceed ‘downhill’. For enzyme, when the reactants are more than the products, the reaction proceeds to the right of the reaction. Career proteins also carry molecules down their concentration gradient.
  3. Both career proteins and enzymes are not denatured  during the process of their biological activity

4 0
3 years ago
Other questions:
  • What are the skin layers from inside and outside of your body
    11·1 answer
  • What occurs during the process of condensation in the water cycle?
    14·2 answers
  • Infer the consequences for evolution if species did not vary
    6·1 answer
  • Athlete's foot is a common fungal infection that can cause itchy, scaly skin. The fungus that causes Athlete's foot lives and gr
    5·2 answers
  • An ___________ is when you gather facts through observation, questioning, or studying.
    14·2 answers
  • Desert animals are active at night to avoid the heat.Which type of adaptation is this?
    9·1 answer
  • Pls answer all the questions​
    8·1 answer
  • All of the following affect the climate of an area except
    5·2 answers
  • The slogan "reduce, reuse, recycle was used to educate the community on
    11·1 answer
  • Hemophilia is a genetic disorder which prevents wounds from clotting properly. If you know that the blood of hemophiliacs does c
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!