1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
3 years ago
10

Which of the following is a stressful environmental condition found in degraded areas of New York City?

Biology
2 answers:
Westkost [7]3 years ago
8 0
It is option D that is <span>Brownfields tend to be cooler and drier than other areas.
Hope it helps </span>
Alenkasestr [34]3 years ago
3 0

actually, the answer is A i just took the test :)


You might be interested in
Who proposed that traits acquired during one lifetime could be oassed to the next generation
aleksklad [387]

Answer:

Jean-Baptiste Lamarck

Explanation:

Just look it up

4 0
3 years ago
HeLP! HeLp ajanjbhdwfbhfrehgbfehrjbger
fredd [130]
Hope this helps. Heiendisksosnsixnsj

6 0
3 years ago
Read 2 more answers
Why is fishing for some kinds of ocean fish controlled by laws?
lora16 [44]
C is the answer. Due to the current state of the world economy; people, if left to their own devices, would fish as much as possible so they can sell their fish to make money. Current technology means we can catch as many fish as we want (trawlers etc.). The problem with this is that there is only a finite amount of fish in the sea. If we were to fish them without limits in place, we could cause them to go extinct.
8 0
3 years ago
What is the difference between asexual and sexual reproduction?
dalvyx [7]
One is were you bang someone else to reproduce and the other is where you bang yourself to reproduce
7 0
4 years ago
DNA____.
Luden [163]

The answer for this question is C, I just did my final for Biology and got a good score in it.

Hope it helps!

7 0
4 years ago
Other questions:
  • Why does it matter if there is a difference between 160 calories in almonds compared to 160 calories in soda?
    10·1 answer
  • 23 points!!! Answer 1,2,3,4,5
    13·1 answer
  • A solution that causes water to move out of a cell
    13·1 answer
  • Why is allowing complete chest recoil important when performing high quality CPR?
    6·1 answer
  • A population of bacteria is treated with an antibiotic. It is estimated that 5,000 live bacteria existed in the sample before tr
    14·2 answers
  • I need help with this question
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In a _____, people use communication primarily to exchange facts and information. a. collectivistic b. feminine culture c. high-
    8·1 answer
  • Oxygen weathers rock through a process called
    14·1 answer
  • Isotopes are atoms of the same element with the same number of protons and ________________.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!