1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr Goodwill [35]
3 years ago
15

How many rings does chlorophyll a and b have​

Biology
1 answer:
In-s [12.5K]3 years ago
6 0

Explanation:

Each has one chlorin ring- chlorin is a form of porphyrin.

Chlorophylls  are comprised of a ringed molecule, chlorin, a hydrogenated form of porphyrin which contains a magnesium ion at the center, bonded to four atoms of nitrogen.  Varying types of Chlorophyll have side chains, which affect the absorption spectrum of the molecule for instance A has a methyl group bonded to the C7 position, while B has an aldehyle (CHO) group at this location.

Embedded within the thykaloid membrane of chloroplasts, chlorophyll a and B mainly absorb orange-red and violet-blue wavelengths and convert light energy into chemical energy for the process of photosynthesis. This occurs in the light-dependent reactions of photosynthesis, within chloroplasts of plants. The range of wavelengths absorbed by a pigment is its absorption spectrum while it reflects those outside of this range. Plants appear green as this region of light is reflected by the pigments.

Learn more about Photosynthesis at brainly.com/question/4216541

Learn more about cellular life at brainly.com/question/11259903

#LearnWithBrainly

You might be interested in
What creates biomass
OLga [1]

Answer:

cow dung is the source of biomass

Explanation:

Biomass is renewable organic material that comes from plants and animals. ... Biomass contains stored chemical energy from the sun. Plants produce biomass through photosynthesis. Biomass can be burned directly for heat or converted to renewable liquid and gaseous fuels through various processes.

6 0
2 years ago
Why are the enzymes in snake venom so dangerous to the human body?
eduard

Answer:

Snake venom involves enzymes, proteins and substances with a cytotoxic, neurotoxic effect and coagulants.

Explanation:

Snake venom is very deadly because of the enzymes it contains. For example, Snake venom hinders cholinesterase which causes loss of muscle control.

5 0
3 years ago
Read 2 more answers
A liquid that is being heated at Lakesha's lab table catches fire. Which action should Lakesha take first?
BlackZzzverrR [31]
If their is a teacher or a Professor she should go there first if it’s a small fire she needs a fire blanket to take out small fire after reaching an adult
5 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Which of the following is (are) characteristics of a living organism? Choose all that
dalvyx [7]
Reproduction , metabolism ,sweating
4 0
3 years ago
Other questions:
  • Why doesn't asexual reproduction result in variation among offspring and parents?
    9·2 answers
  • How can you distinguish a clastic rock from that of a bioclastic rock
    11·1 answer
  • What are things to look for to know if an example or idea is science or nonscience?
    12·1 answer
  • Nina is exploring her gender identity and sexual orientation.
    11·2 answers
  • What is the basis of the metric measurement system?
    6·2 answers
  • Can DNA be extraxted from living cells only?
    5·1 answer
  • 100 points!! PLEASE ANSWER FAST!!
    7·2 answers
  • What is an electromagnetic wave?<br> Please helppp
    5·1 answer
  • Natural selection may affect allele frequency in populations due to the fundamental forces of evolution except which of the
    7·1 answer
  • Which is the best explanation for where different types if minerals are found in earth
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!