1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
3 years ago
8

If the enzyme polyphenoloxidase is part of a potato's defense against herbivores, what do we expect to see when looking at activ

ity of extracts of peeled potatoes?
Biology
1 answer:
Y_Kistochka [10]3 years ago
8 0
Herbivores are organisms that feed on plants. Plants have different mechanisms of defending against herbivores, mostly by synthesizing compounds that give the plants a bitter or unpleasant taste. The synthesis of these molecules is intensified when the plant and its cells suffer physical damage, so, in the case of peeled potatoes, there should be an increase in activity of this protective enzyme.
You might be interested in
Which characteristic sets hominins apart from other primates?
grigory [225]
Bipedalism is the characteristic that hominins have and sets them apart from other primates. Bipedalism refers to locomoting. It is walking primarily upright on two feet, movement on two feet.
Walking upright distinguishes humans from other primates. Walking<span>, </span>running<span>, or </span>hopping are types of bipedal movement.
5 0
3 years ago
What condition will not increase reaction rate of enzymes
slamgirl [31]

Answer:

Several factors affect the rate at which enzymatic reactions proceed - temperature, pH, enzyme concentration, substrate concentration, and the presence of any inhibitors or activators.

Explanation:

8 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What are the liquids that bridge the gap across synapse
amid [387]

neurotransmitters is the answer

5 0
3 years ago
Which of the following are lipids?
tresset_1 [31]
Waxes (option a) is correct
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which best describes a benefit of using DNA technology in medicine?
    10·2 answers
  • About 1.2 billion years ago, eukaryotic and multicellular organisms evolved because
    10·1 answer
  • What is the relationship between coronary artery disease in a hard attack
    10·1 answer
  • What are valid methods of coping with stress
    8·2 answers
  • If you wanted to make all days on Earth the same length, what would you have to do?
    10·1 answer
  • In ancient times, plant and animal remains got buried, compressed, and transformed into fossil fuels like coal. Burning of these
    11·1 answer
  • How can convergence lead to the formation of clouds
    10·1 answer
  • Well labeled diagram of a tapewom
    13·1 answer
  • WILL GIVE BRAINLIEST... ONLY HAVE 5 MINUTES TO ANSWER
    10·2 answers
  • Write components of xylem and phylem ?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!