1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hram777 [196]
3 years ago
12

What do both the theory of evolution and the cell theory have in common as scientific theories?

Biology
2 answers:
malfutka [58]3 years ago
7 0
A) both have strong scientific support.
Svetach [21]3 years ago
5 0

Answer:

Option (A).

Explanation:

Scientific theory may be defined as the explanation of the natural world that has been verified by the scientific methods. The scientific theory must involve the protocol, observation, result and discussion.

The theory of evolution and the cell theory are included in the scientific theories. These theories have the strong scientific evidence and support that has been tested by the scientists.

Thus, the correct answer is option (A).

You might be interested in
Another application of the Polymerase Chain Reaction (PCR) is to screen samples for the presence of viruses. For example, rememb
yuradex [85]

Answer:

For the 1st part, the correct answer is option C.  

In a polymerase chain reaction, the amplification of DNA template takes place not RNA. So, prior to going into the process, there is a need to initially convert RNA into DNA with the help of an enzyme reverse transcriptase.  

For the 2nd part, the correct answer is option D.  

The suitable temperature for human DNA polymerase is 37 degrees Celsius, and it gets denatured at greater temperatures. As PCR runs at exceedingly high temperature like 95 degrees Celsius, only Taq DNA polymerase can withstand the temperature. Thus, normal DNA polymerase cannot be utilized in the PCR reactions.  

3 0
3 years ago
Describe how surface currents would be affected if earth did not rotate
Tanya [424]
<span>When the earth spins in a certain direction, the ocean currents move in the opposite direction, sort of like when a car moves forward you are pulled backwards. However, there would still be wind and the gravitational pull of the moon which causes currents. The rotation of the earth just sort of "accents" these. So as a result, you would have many more smaller ocean current cycles.
</span>
7 0
3 years ago
What happens to a molecule when it is phosphorylated
lesya [120]

It has increased chemical reactivity and it is primed to do cellular work.

3 0
3 years ago
What happens to kinetic energy of molecules with increased temperature
erik [133]

Answer:

The kinetic energy of molecules increase with the increase in temperature.

Explanation:

when the temperature rises the individual molecules collide with each other, hence raising the kinetic energy.

considering the gas molecules:

K.E= 3/2 nRT

where R represents the universal gas constant

n represents the total number of moles

T represents the temperature

this equation clearly states that kinetic energy is directly related with the increase in temperature.

5 0
3 years ago
Read 2 more answers
Describe how enzymes regulate chemical reactions within an organism
Yanka [14]
Essentially, enzymes<span> are biological catalysts that speed up biochemical </span>reactions<span>. State the role of energy in </span>chemical reactions<span>. Explain the importance of </span>enzymes<span> to living </span>organisms<span>. Explain </span>how enzymes regulate<span> biochemical </span>reactions within<span> a cell.</span>
8 0
3 years ago
Other questions:
  • People sweat to help maintain body temperature. What type of feedback happens when sweating regulates body temperature?
    7·2 answers
  • What is the superfund
    8·2 answers
  • What effect would fertilizers have if they entered the st.johns river ecosystem?
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Why is soil important to plants?
    8·2 answers
  • Which of the following animals could be considered a member of these loons' population?
    7·2 answers
  • How is a scientific hypothesis best evaluated?
    13·2 answers
  • 9. How do the quantities of ATP formed during aerobic and anaerobic respiration compare? (1 point)
    5·2 answers
  • student needs to find the density of a cube. Each side of the cube measures 3 cm, and the mass of the cube is 12 g. What is the
    8·1 answer
  • (Only answer it if you know the answers)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!