1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanzania [10]
3 years ago
13

The Office of Ecology and Natural Resource Conservation works to _______. a. end the use of natural resources b. maintain the su

pply of domestic natural resources c. develop foreign policy regarding the sustainable use of natural resources d. limit the use of critical natural resources in the United States
Biology
1 answer:
lara [203]3 years ago
7 0

Answer:

d

Explanation:

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Photosynthesis and Cell Respiration Questions.
monitta

Answer:

1.) a

2.) b

3.) c

4.) a

5.) b

6.) Are there any other options? none of those options are right because energy is released from ATP when a phosphate group is removed.

7 0
3 years ago
What type of organism moves using cilia
const2013 [10]
Paramecium move using cilia
5 0
3 years ago
Read 2 more answers
1. The point where the muscle attaches to the bone to be pulled is called the ________.
deff fn [24]
I think it is b
then b
3 0
3 years ago
Question 7 which of these has the greatest mobility? the unicellular euglena the slime molds the mat-forming algae all have the
zvonat [6]
I believe the answer is Unicellular Euglena. 
Euglena are unicellular organisms classified into the kingdom protista, and the phylum euglenophyta. All euglena have chloroplast and can make their own food by photosynthesis. They are considered to have both plant and animal features. The mobility of Euglena also allows for hunting capability, because of this adaptation. 
8 0
3 years ago
Other questions:
  • What are the appendages of a sea anenome called?
    8·1 answer
  • Fats are digested in the
    5·2 answers
  • An allergic response is NOT typically caused by
    9·1 answer
  • In an hiv-infected cell producing hiv virus particles, the viral glycoprotein is expressed on the plasma membrane. how do the vi
    15·1 answer
  • The nurse caring for a client with tuberculosis anticipates administering which vitamin with isoniazid (inh) to prevent inh-asso
    15·1 answer
  • What computer generated document helps organize and display data?
    14·1 answer
  • How many molecules of carbon dioxide (CO2) would be produced by five turns of the citric acid cycle?
    7·1 answer
  • Help with 3! Pleassseee BIOLOGY
    9·1 answer
  • What happens to the structure of the kit receptor protein
    6·1 answer
  • The Arctic Desert partially occupies the territory of which country? ​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!