1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
15

What is the median of this set of data? 66, 51, 77, 68, 60, 75, 54, 80

Mathematics
2 answers:
olga nikolaevna [1]3 years ago
5 0

67````````````````````````

labwork [276]3 years ago
3 0
51, 54, 60, 66, 68, 75, 77, 80 The median is 67
You might be interested in
Awnser in one/two step equations
solniwko [45]
-6=-7+x

Make the variable to the left hand side and change it’s sign.

-6-x=-7

Move the constant to the right hand side and change its sign.

-x=-7+6

Calculate the sum

-x=-1

Change the signs of both sides of the equation .

X=1
5 0
3 years ago
Read 2 more answers
Fourth grade level. Use mental math to find 7x53
Mrrafil [7]

Answer:

371


Step-by-step explanation:


7 0
3 years ago
Read 2 more answers
Which of the following is a example of a infinite decimal?
olga_2 [115]

C

Step-by-step explanation:

pi goes on infinitely so no matter what its multiplied by it would go on infinitely

4 0
3 years ago
Find the absolute value and the opposite of the integer.
Talja [164]
The absolute value is always non-negative!

So the absolute value of 57 is 57 itself, as it's non-negative (i.e. it's positive or 0).

Opposite value is the number with a different sign: an opposite value of a positive number is negative, so here it will be -57 .

The correct answer is C. 

7 0
3 years ago
Read 2 more answers
Round 471.42857 to the nearest cent
KATRIN_1 [288]

Answer:

471

Step-by-step explanation:

do to the number in the tenths place not being higher than 5 all number past the decimal become zero and the whole number stay the same

6 0
3 years ago
Other questions:
  • Find the circumference <br> (3.14)(24)
    11·1 answer
  • When constructing an inscribed square, how many lines will be drawn in the circle? (6 points) A. 2 B. 3 C .5 D. 7
    14·1 answer
  • Can someone please help me I really need help please help me thank you
    6·2 answers
  • Consider the following data sets and complete the table of summary data
    12·1 answer
  • PLS give answer ASAP
    9·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Find the value of k so that the remainder is -12 for (2x^4+ 4x^3-7x^2- kx +9)/(x-1).
    11·1 answer
  • What is the length, in units, of the hypotenuse of a right triangle if each of the two legs is 2 units? (5 points)
    7·2 answers
  • - C C) C.P = Rs 20, profit Rs 2, S<br>.P. -​
    13·1 answer
  • PLEASE HELP this is a missing assignment i will mark brainliest
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!