1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
12

Mendel’s law of segregation has its physical basis in which of the phases of the cell cycle?

Biology
2 answers:
ladessa [460]3 years ago
7 0

Answer: it has physical basis in Meiosis I particularly Anaphase I and meiosis II particularly Anaphase II.

Explanation: Because in Anaphase I spindle get far apart from each other and chromosomes segregation results. In this phase as a result of segregation 2 daughter cells are formed and in Anaphase II, 4 haploid cells are formed.

ollegr [7]3 years ago
3 0

Answer:

Meiosis

Explanation:

Because that's when alleles of different genes cross over, specifically in Prophase I.

You might be interested in
What is the relationship between the greenhouse effect and global warming
elena-s [515]
The greenhouse effect is a natural process traps heat in the atmosphere - global warming tends to be when additional greenhouse gases are released into the atmosphere and this causes a warming event.
7 0
3 years ago
Read 2 more answers
HELP. can someone please answer these questions for me.
rewona [7]

Answer:

The process illustrated in the diagram is the non light dependent reactions of photosynthesis termed as Calvin Cycle.

Explanation:

  • Two molecules of 3-phosphoglycerate (3-PGA) are produced or released from step one to step two of Calvin cycle.
  • The source of energy that helps to start step one are ATP and NADPH, mainly derived from the light dependent reaction.
  • The oxygen molecule thus formed by splitting of water is release to the nature as oxygen, which living organisms utilizes in respiration.
  • Carbon dioxide comes from the atmosphere to start the process.
  • Light reactions occurs in the thylakoid membranes of the plant organelles namely chloroplasts.
  • Non-light dependent reaction or Calvin cycle takes place in the stroma chloroplasts.
6 0
3 years ago
What three parts make up the nervous system?
oee [108]

Answer:brain

Spinal cord

Explanation: the two make up the nervous system

8 0
2 years ago
Read 2 more answers
8. Energy within an ecosystem fovrs from the producers to the consumers. However, a very important group of
VikaD [51]

Answer:

A

Explanation:

5 0
2 years ago
What is a subspecies?
marysya [2.9K]
A subspecies is a taxonomy category that ranks below species, usually permanent geographical isolated race.   <span />
6 0
3 years ago
Other questions:
  • Hormone molecule performes its function
    5·2 answers
  • 1.Andrea is viewing a plant cell with a compound microscope. She notices a large, "empty" structure. When Andrea adds salt water
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following does not occur during interphase?
    5·1 answer
  • In 1895, a German physicist named Wilhelm Roentgen was conducting experiments with vacuum tubes, which he kept completely closed
    9·1 answer
  • As the human population grows, some minerals in everyday products could
    9·2 answers
  • How do human activities *affect the rate* that organisms become extinct
    7·1 answer
  • Answer number 5 HURRY PLEASE
    5·2 answers
  • I'm learning about photosynthesis and cellular respiration and wonder how cellular respiration works for plants.
    13·2 answers
  • Part C
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!