1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rosijanka [135]
3 years ago
11

Our solar system includes

Biology
1 answer:
VMariaS [17]3 years ago
8 0

Answer:

d

Explanation:

im pretty sure , srry if wrong

You might be interested in
What is greenhouse gas?
Ksju [112]

Answer:

d

Explanation:

I don't know, I'm just assuming

5 0
2 years ago
If yellow skin (Y) exhibits incomplete dominance with red skin (y), what color of skin would result from the genotype Yy?
GREYUIT [131]

Answer:

Orange skin

Explanation:

Incomplete dominance with the genotype Yy results in a combination of the dominant and recessive traits. In this case the combination of yellow and red skin would be orange skin.

5 0
3 years ago
Read 2 more answers
In this assignment, you will use simulations to analyze how climate, resources, and habitat size affect
max2010maxim [7]

Answer:

Larger habitats support populations with higher carrying capacities. Higher quality habitats support populations with higher carrying capacities. There is no difference in population growth rate between large and small habitats. Some major threats to biodiversity are: Habitat destruction/Deforestation, Introduced and invasive species, Genetic pollution, Over exploitation, Hybridization, Climate change, Diseases, Human overpopulation. If abiotic or biotic factors change, the carrying capacity changes as well. Natural disasters can destroy resources in an ecosystem. If resources are destroyed, the ecosystem will not be able to support a large population. This causes the carrying capacity to decrease.  

Carrying capacity could be reduced if each individual within the species consumed less from the environment. Think about humans: if every human needs a four car garage and a large house, the planet can sustain fewer humans than if each human lived in a studio apartment and traveled using a bicycle. It would take 1.75 Earths to sustain our current population. If current trends continue, we will reach 3 Earths by the year 2050. It is beyond dispute that the modern industrial world has been able to temporarily expand Earth's carrying capacity for our species. As Nordhaus points out, population has grown dramatically (from less than a billion in 1800 to 7.6 billion today), and so has per capita consumption. Historically, habitat and land use change have had the biggest impact on biodiversity in all ecosystems, but climate change and pollution are projected to increasingly affect all aspects of biodiversity. Sustainable agriculture practices support integrating biodiversity in various ways including in terms of diversity of crops, traditional agriculture techniques to control pests and increase productivity as well as ensuring that farmed land is made up of a diverse mix of grazing land, crop land, orchards, wetlands and more.

Explanation:

Hope this helps :)

5 0
3 years ago
Blood type is determined by the<br> the blood cells.<br> DONE
Marina CMI [18]

Answer:

Yes

Explanation:

3 0
3 years ago
Read 2 more answers
What is the typical flow of energy throughout organisms?​
Alborosie

starts with sunlight and photosynthesis if you are talking about plants

6 0
3 years ago
Read 2 more answers
Other questions:
  • Were are chromosomes found in an animal cell?
    7·1 answer
  • Is atmospheric nitrogen easily used by plants​
    13·1 answer
  • Which of the following is an example of a decomposer?
    6·2 answers
  • Why do innie belly buttons pop out during pregnancy, but not weight gain?
    12·1 answer
  • How does the brain control human behavior? Select one:
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Study the diagram of a cell.
    12·1 answer
  • If four cells went through mitosis at the same time how many daughter cells would be formed? ​
    7·1 answer
  • Seat have even though all selection to have different colors on the bellies than they have on their backs which statement best d
    5·1 answer
  • 1. How does the marine biome retain its salinity?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!